Individual-group diagnostic, all groups
Listing groups by interaction signature
Group 335 is from IL_81522.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_81522.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GUUAC*GUUC (   1) MLPS  -6.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_81522.2  4M6D G   28 C   39'

 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   0 Score 1.00           GUUAC*GUUC (   1) MLPS  -6.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_81522.2  4M4O G   28 C   39'

 matches the original group, cWW-L-L-cWW
Better:   0 Equal:   0 Score 1.00             UAGGC*GG (   1) MLPS  -9.53 deficit   3.16 prct   0.00 CutScore  66.68;  Ed  0, 0
ans =

    ' IL_81522.2  6XJQ U   42 G   17'

 matches the original group, cWW-L-L-cWW
Group 365 is from IL_87290.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_87290.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CCGACCUUGAAAUAC*GGAGG (   1) MLPS -13.47 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87290.1  5J7L C 2160 G 2128'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L
Group 219 is from IL_54737.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_54737.1
This group is considered to be structured ***************************
Number of NTs: 20  Signature: cWW-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CCUUGAUGUGUAGGAUAG*CCUUUAAUG (   1) MLPS -21.00 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_54737.1  5J7L C 2103 G 2186'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R
Group  55 is from IL_13394.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_13394.1
This group is considered to be structured ***************************
Number of NTs: 21  Signature: cWW-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 AAUGUGCCUUCGGGAAC*GAAGUU (   1) MLPS -16.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13394.1  5J7L A 1021 U 1008'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R
Group  65 is from IL_15991.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_15991.1
This group is considered to be structured ***************************
Number of NTs: 21  Signature: cWW-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GCGUACUGGACCCA*UGGCCGGUC (   1) MLPS -16.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15991.1  8CRE G  669 C  656'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-cWW-L-L
Group  86 is from IL_20245.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_20245.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-L-R-L-R-L-R-L-R-L-R-L-R-L-cWW-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GAUGUGUAGGAUAGGUG*CACCCUUU (   1) MLPS -18.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_20245.1  5J7L G 2107 U 2182'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-R-L-cWW-L-L-R-L
Group 307 is from IL_74746.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_74746.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-L-R-L-R-L-R-L-R-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   GAAACCGCG*UUCGCUCC (   1) MLPS -14.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_74746.1  3HJW G    9 C   46'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00    CUUGAGUG*UAAUUAUG (   1) MLPS -14.90 deficit   0.40 prct   0.00 CutScore  98.01;  Ed  0, 0
ans =

    ' IL_74746.1  3HAX C    9 G   49'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-R-cWW
Group 135 is from IL_31915.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31915.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-L-R-L-R-L-R-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    GUUUUUAUC*GUUUUUC (   1) MLPS  -8.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31915.1  3P22 G   26 C   13'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00    GUUUUUAUC*GUUUUUC (   1) MLPS  -8.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31915.1  6X5M G   25 C    9'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00     GUUUUUAC*GGUUUUC (   1) MLPS  -9.73 deficit   1.22 prct   0.00 CutScore  94.23;  Ed  0, 0
ans =

    ' IL_31915.1  7JNH G    8 C   79'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-cWW
Group 233 is from IL_58126.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_58126.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-L-R-L-R-L-R-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    GGAUAAAUC*GGAAUAC (   1) MLPS -11.42 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_58126.1  8P9A G  517 C  573'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00     CACGAAUU*ACAGAUG (   1) MLPS -13.24 deficit   1.82 prct   0.00 CutScore  90.92;  Ed  0, 0
ans =

    ' IL_58126.1  6VMY C  326 G  348'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-R-L-cWW
Group 374 is from IL_89047.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_89047.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-L-R-L-R-L-R-L-R-L-cWH-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   CUUGGAUUUA*UUGUCAG (   1) MLPS  -9.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89047.1  8CRE C  895 G  884'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-cWH-L-cWW
Group  25 is from IL_05472.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_05472.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-L-R-L-R-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    GUUUUUAACG*CUUUUC (   1) MLPS  -9.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_05472.1  7JNH G   24 C   64'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-cWW-L
Group  16 is from IL_04307.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_04307.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-L-R-L-R-L-R-L-R-L-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    CCAUACCUUG*CCUCAG (   1) MLPS -10.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04307.1  7VYX C   41 G   21'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-cWW-L-L-R
Group 298 is from IL_73002.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_73002.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-L-R-L-R-L-R-L-R-L-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  UGGAUUUCCAA*UUGGCCG (   1) MLPS -12.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_73002.1  8P9A U  675 G  655'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-cWW-L-L-R
Group 172 is from IL_43467.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_43467.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-L-R-L-R-L-R-L-R-L-cWW-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 AGACGGCACCC*GAAGGCAU (   1) MLPS -12.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_43467.1  1U6B A  134 U  173'

 matches the original group, cWW-L-R-L-R-L-R-L-R-L-cWW-L-L-R-L
Group 228 is from IL_57741.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_57741.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-L-R-L-R-L-R-L-R-L-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00   CUUGGAUUUA*UUGUCAG (   1) MLPS -10.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_57741.1  8P9A C  910 G  899'

 scores better against   1 groups: IL_89047.1, 16 NTs, cWW-L-R-L-R-L-R-L-R-L-cWH-L-cWW         , Ed  0, 0, MLPS -9.72, deficit  0.00, prct   0.00; 
Group  22 is from IL_04736.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_04736.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-R-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CGCAUAG*CGCAUAG (   1) MLPS  -8.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04736.1  3SIV C   40 G   46'

 matches the original group, cWW-L-R-L-R-L-R-L-R-cWW
Group 147 is from IL_34822.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_34822.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-R-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        AAAAAU*GCCAAU (   1) MLPS  -9.46 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_34822.1  3PDR A   60 U   81'

 matches the original group, cWW-L-R-L-R-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00       CCAACU*ACGAACG (   1) MLPS  -9.83 deficit   0.37 prct   0.00 CutScore  97.83;  Ed  0, 0
ans =

    ' IL_34822.1  4V9F C 1578 G 1618'

 matches the original group, cWW-L-R-L-R-L-R-L-R-cWW
Group 178 is from IL_44438.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_44438.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-R-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UGAUCU*AGCGUA (   1) MLPS  -7.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_44438.1  8F4O U   59 A   80'

 matches the original group, cWW-L-R-L-R-L-R-L-R-cWW
Group 296 is from IL_71294.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_71294.3
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-R-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CCAGGU*GAGCAG (   1) MLPS  -7.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_71294.3  1L9A C  190 G  209'

 matches the original group, cWW-L-R-L-R-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00        AGAGAC*GUCAAU (   1) MLPS -11.53 deficit   3.60 prct   0.00 CutScore  79.94;  Ed  0, 0
ans =

    ' IL_71294.3  4N0T A   95 U   36'

 matches the original group, cWW-L-R-L-R-L-R-L-R-cWW
Group 339 is from IL_82292.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82292.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-R-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CCUUGG*CCUUGG (   1) MLPS -10.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82292.1  4EYA C    5 G   10'

 matches the original group, cWW-L-R-L-R-L-R-L-R-cWW
Better:   1 Equal:   0 Score 0.00        CGCAAG*CGCAAG (   1) MLPS -10.90 deficit   0.70 prct   0.00 CutScore  95.81;  Ed  0, 0
ans =

    ' IL_82292.1  8SSW C   11 G   16'

 scores better against   1 groups: IL_49767.8, 11 NTs, cWW-cWW-tWH-L-tHS-cWW                   , Ed  4, 2, MLPS -7.50, deficit  0.75, prct   0.00; 
Better:   0 Equal:   0 Score 1.00        UACAGA*UAGGUA (   1) MLPS -12.49 deficit   2.29 prct   0.00 CutScore  86.27;  Ed  0, 0
ans =

    ' IL_82292.1  3IGI U  214 A  163'

 matches the original group, cWW-L-R-L-R-L-R-L-R-cWW
Group 375 is from IL_89099.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_89099.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-R-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGGAGC*GGGAGC (   1) MLPS  -5.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89099.1  1D4R G   12 C   17'

 matches the original group, cWW-L-R-L-R-L-R-L-R-cWW
Group   6 is from IL_01176.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_01176.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CGCCUU*AAAAG (   1) MLPS  -9.12 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_01176.1  6FZ0 C   24 G   43'

 matches the original group, cWW-L-R-L-R-L-R-L-cWW
Group  69 is from IL_16665.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_16665.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GAAUUGUUG*CUAAC (   1) MLPS -10.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_16665.1  5KPY G   47 C   75'

 matches the original group, cWW-L-R-L-R-L-R-L-cWW
Group 169 is from IL_42778.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_42778.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CAGCAG*CAGCAG (   1) MLPS  -8.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42778.1  6QIT C    2 G    7'

 matches the original group, cWW-L-R-L-R-L-R-L-cWW
Group 128 is from IL_31084.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31084.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-R-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00        UGAACCG*CAAAA (   1) MLPS  -8.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31084.1  1L9A U  181 A  216'

 scores better against   1 groups: IL_85652.1, 12 NTs, cWW-tSH-L-R-L-R-L-cWW-L                 , Ed  0, 0, MLPS -7.60, deficit  0.00, prct   0.00; 
Group  54 is from IL_13358.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_13358.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-L-R-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UUCUUUGUA*UGGGG (   1) MLPS  -9.00 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13358.1  8P9A U  245 G  173'

 matches the original group, cWW-L-R-L-R-L-R-L-cWW-L-L
Group 321 is from IL_78349.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_78349.3
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-L-R-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UGAAAGAC*GGGGAG (   1) MLPS -10.12 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_78349.3  4LFB U  605 G  633'

 matches the original group, cWW-L-R-L-R-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00      UGAAAUCC*GAACUG (   1) MLPS -10.12 deficit   0.00 prct   0.00 CutScore  99.99;  Ed  0, 0
ans =

    ' IL_78349.3  5J7L U  605 G  633'

 matches the original group, cWW-L-R-L-R-L-R-L-cWW-L-L
Group 322 is from IL_78472.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_78472.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-L-R-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GGCGGAAA*UGGGC (   1) MLPS  -9.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_78472.1  5UNE G   31 C   14'

 matches the original group, cWW-L-R-L-R-L-R-L-cWW-L-L
Group 260 is from IL_64403.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_64403.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-L-R-L-R-L-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    UGUGCCAAUGG*CAAAG (   1) MLPS -10.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_64403.1  5U30 U   28 G   58'

 matches the original group, cWW-L-R-L-R-L-R-L-cWW-L-L-R
Group  77 is from IL_18487.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_18487.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-L-R-L-R-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GAAAGCA*UUAAGC (   1) MLPS  -5.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_18487.1  8P9A G   21 C   58'

 matches the original group, cWW-L-R-L-R-L-R-L-cWW-cWW
Better:   0 Equal:   0 Score 1.00       GAAAGCA*UUAAGC (   1) MLPS  -5.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_18487.1  8OI5 G   21 C   58'

 matches the original group, cWW-L-R-L-R-L-R-L-cWW-cWW
Group  91 is from IL_21630.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21630.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-L-R-L-R-L-R-cSH-R-tWH-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   GAGCCCAAC*GGCUAGAC (   1) MLPS -11.62 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_21630.1  8Z8U G    6 C   36'

 matches the original group, cWW-L-R-L-R-L-R-cSH-R-tWH-R-cWW-cWW
Group 103 is from IL_25186.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25186.4
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CACCC*GACAAG (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_25186.4  3BNN C    5 G   17'

 matches the original group, cWW-L-R-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00         CACCC*GACAAG (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_25186.4  3BNN C    5 G   17'

 matches the original group, cWW-L-R-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00         GACCC*GACAAC (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_25186.4  7Q80 G   14 C   35'

 matches the original group, cWW-L-R-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00         GACCC*GACAAC (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_25186.4  8ZAU G   12 C   38'

 matches the original group, cWW-L-R-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00         GACCC*GACAAC (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_25186.4  7Q80 G   14 C   35'

 matches the original group, cWW-L-R-L-R-L-R-cWW
Better:   6 Equal:   0 Score 0.00         CUAAG*UGAUGG (   1) MLPS -16.00 deficit  10.26 prct   0.00 CutScore  44.53;  Ed  0, 0
ans =

    ' IL_25186.4  4WF9 C 1511 G 1570'

 scores better against   6 groups: IL_01038.1, 10 NTs, cWW-tWH-L-R-tHS-cWW                     , Ed  5, 3, MLPS -8.15, deficit  1.35, prct   0.00; IL_00981.1, 10 NTs, cWW-tWH-tHH-tHS-cWW                     , Ed  5, 1, MLPS -12.60, deficit  8.21, prct   0.00; IL_70627.3, 10 NTs, cWW-L-R-tHW-cWW                         , Ed  4, 2, MLPS -12.86, deficit  6.13, prct   0.00; IL_38507.2,  9 NTs, cWW-tWH-L-tHS-cWW                       , Ed  2, 1, MLPS -12.87, deficit  7.78, prct   0.00; IL_12697.1, 10 NTs, cWW-cWW-L-R-tHS-cWW                     , Ed  6, 3, MLPS -12.91, deficit  4.98, prct   0.00; 
Group 306 is from IL_74367.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_74367.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GUUUG*CGUAC (   1) MLPS  -5.25 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_74367.1  8CRE G  678 C  698'

 matches the original group, cWW-L-R-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00          GUUUG*CAUAC (   1) MLPS  -7.16 deficit   1.91 prct   0.00 CutScore  88.11;  Ed  0, 0
ans =

    ' IL_74367.1  8P9A G  680 C  700'

 matches the original group, cWW-L-R-L-R-L-R-cWW
Group 327 is from IL_80231.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80231.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-L-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         AAGAAG*CCACU (   1) MLPS  -9.12 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80231.1  5J7L A 1430 U 1470'

 matches the original group, cWW-L-R-L-R-L-R-tHS-cWW
Better:   1 Equal:   0 Score 0.00        GAUGAAA*UAACC (   1) MLPS -10.26 deficit   1.14 prct   0.00 CutScore  93.05;  Ed  0, 0
ans =

    ' IL_80231.1  5XTM G    8 C   39'

 scores better against   1 groups: IL_59258.1, 12 NTs, cWW-L-R-L-R-L-cWW-L-cWW                 , Ed  0, 0, MLPS -7.60, deficit  0.00, prct   0.00; 
Group  78 is from IL_19048.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_19048.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-L-R-L-cSH-L-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     AGGUCACA*UUAAGGU (   1) MLPS  -8.19 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_19048.1  4WF9 A   20 U   59'

 matches the original group, cWW-L-R-L-R-L-cSH-L-R-cWW-cWW
Group  28 is from IL_06300.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06300.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UGAUG*UUAA (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_06300.1  4WF9 U  889 A  978'

 matches the original group, cWW-L-R-L-R-L-cWW
Group  66 is from IL_16218.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_16218.2
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GAAUC*GUGGC (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_16218.2  8P9A G 1250 C 1238'

 matches the original group, cWW-L-R-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00          GAAUC*GUGGC (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_16218.2  8CRE G 1246 C 1234'

 matches the original group, cWW-L-R-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00          CACCC*GUUGG (   1) MLPS  -7.93 deficit   1.59 prct   0.00 CutScore  89.40;  Ed  0, 0
ans =

    ' IL_16218.2  7A0S C 1087 G 1074'

 matches the original group, cWW-L-R-L-R-L-cWW
Group  95 is from IL_22564.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_22564.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GUCUAAC*GUAAUC (   1) MLPS  -9.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22564.1  8P9A G 1488 C 1518'

 matches the original group, cWW-L-R-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00      GUAUAAGC*GAAAUC (   1) MLPS -11.06 deficit   1.56 prct   0.00 CutScore  90.94;  Ed  0, 0
ans =

    ' IL_22564.1  8CRE G 1474 C 1505'

 matches the original group, cWW-L-R-L-R-L-cWW
Group 182 is from IL_45444.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_45444.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CCGAGC*GGAG (   1) MLPS  -5.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_45444.1  1NUV C   22 G   46'

 matches the original group, cWW-L-R-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00          CCGAGC*GGAG (   1) MLPS  -5.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_45444.1  1NUV C   22 G   46'

 matches the original group, cWW-L-R-L-R-L-cWW
Group 224 is from IL_56317.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_56317.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GGAAUA*UCUUC (   1) MLPS  -6.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_56317.1  8CRE G 1807 C 1627'

 matches the original group, cWW-L-R-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00         GGAAUA*UCUUC (   1) MLPS  -6.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_56317.1  8P9A G 1811 C 1631'

 matches the original group, cWW-L-R-L-R-L-cWW
Group 280 is from IL_68909.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_68909.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00           GUAUC*GUUC (   1) MLPS  -8.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68909.1  8CRE G  161 C  259'

 scores better against   1 groups: IL_65718.4,  9 NTs, cWW-cSH-cWS-cWW-cWW                     , Ed  3, 3, MLPS -6.77, deficit  1.07, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           GAUUC*GGCU (   1) MLPS  -9.65 deficit   0.95 prct   0.00 CutScore  90.78;  Ed  0, 0
ans =

    ' IL_68909.1  8CRE G 2835 U 2798'

 scores better against   1 groups: IL_51479.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  5, 2, MLPS -9.35, deficit  2.35, prct   0.00; 
Better:   0 Equal:   0 Score 1.00           GGAGG*CGCC (   1) MLPS  -9.91 deficit   1.21 prct   0.00 CutScore  88.26;  Ed  0, 0
ans =

    ' IL_68909.1  1J2B G  943 C  929'

 matches the original group, cWW-L-R-L-R-L-cWW
Better:   2 Equal:   0 Score 0.00           GGCCC*GGGC (   1) MLPS -10.36 deficit   1.65 prct   0.00 CutScore  83.96;  Ed  0, 0
ans =

    ' IL_68909.1  4DB2 G    6 C    8'

 scores better against   2 groups: IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  4, 2, MLPS -8.44, deficit  3.73, prct   0.00; IL_58112.2,  8 NTs, cWW-cWW-L-R-cWW                         , Ed  2, 2, MLPS -9.11, deficit  2.04, prct   0.00; 
Better:   1 Equal:   0 Score 0.00          CAUGG*UAUAG (   1) MLPS -12.65 deficit   3.95 prct   0.00 CutScore  61.70;  Ed  0, 0
ans =

    ' IL_68909.1  8CRE C 2422 G 2481'

 scores better against   1 groups: IL_26728.3,  9 NTs, cWW-cSH-R-cSH-cWW-cWW                   , Ed  3, 3, MLPS -11.98, deficit  6.84, prct   0.00; 
Better:   3 Equal:   0 Score 0.00         GAUCAC*GGAAC (   1) MLPS -13.23 deficit   4.53 prct   0.00 CutScore  56.08;  Ed  0, 0
ans =

    ' IL_68909.1  4PHY G   17 C   34'

 scores better against   3 groups: IL_88269.4, 11 NTs, cWW-tWW-cSH-tWH-tHS-cWW                 , Ed  5, 2, MLPS -11.24, deficit  3.60, prct   0.00; IL_97631.1, 11 NTs, cWW-L-R-L-R-L-tHS-cWW                   , Ed  8, 4, MLPS -12.03, deficit  5.00, prct   0.00; IL_94351.1, 11 NTs, cWW-L-R-L-R-L-tHS-cWW                   , Ed  8, 4, MLPS -12.63, deficit  4.15, prct   0.00; 
Group 310 is from IL_75294.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_75294.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00          GCGAGG*CAAC (   1) MLPS  -7.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_75294.1  5WTI G    0 C   28'

 scores better against   1 groups: IL_45444.1,  9 NTs, cWW-L-R-L-R-L-cWW                       , Ed  5, 1, MLPS -7.13, deficit  1.85, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CCGAC*GGGG (   1) MLPS  -9.03 deficit   1.11 prct   0.00 CutScore  91.22;  Ed  0, 0
ans =

    ' IL_75294.1  9DFE C 2870 G 2846'

 scores better against   1 groups: IL_70335.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  6, 2, MLPS -8.96, deficit  3.48, prct   0.00; 
Group  24 is from IL_05192.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_05192.4
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00          CGAACG*CAAG (   1) MLPS  -9.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_05192.4  7A0S C  354 G  306'

 scores better against   1 groups: IL_11344.2,  5 NTs, cWW-cSS-L-cWW                           , Ed  3, 1, MLPS -8.53, deficit  0.12, prct   0.00; 
Better:   0 Equal:   0 Score 1.00          GGGUCG*CCCC (   1) MLPS  -9.06 deficit   0.01 prct   0.00 CutScore  99.92;  Ed  0, 0
ans =

    ' IL_05192.4  7A0S G   51 C   35'

 matches the original group, cWW-L-R-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          UAUUGG*CAGG (   1) MLPS  -9.72 deficit   0.68 prct   0.00 CutScore  95.09;  Ed  0, 0
ans =

    ' IL_05192.4  3CUL U   44 G   25'

 matches the original group, cWW-L-R-L-R-L-cWW-L
Group 197 is from IL_49612.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_49612.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CGGCAU*AUGG (   1) MLPS -10.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_49612.1  5J7L C 1051 G 1207'

 matches the original group, cWW-L-R-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00        GUCUGUGA*UGGC (   1) MLPS -10.87 deficit   0.09 prct   0.00 CutScore  99.38;  Ed  0, 0
ans =

    ' IL_49612.1  8CRE G 1415 C 1264'

 matches the original group, cWW-L-R-L-R-L-cWW-L
Group 138 is from IL_33141.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_33141.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CCCUUGG*CCAG (   1) MLPS  -7.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_33141.1  8DK7 C   21 G   11'

 matches the original group, cWW-L-R-L-R-L-cWW-L-L
Group 217 is from IL_54050.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_54050.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     UAGUGUCCUUG*CAAG (   1) MLPS -10.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_54050.1  4KR6 U    8 G   28'

 matches the original group, cWW-L-R-L-R-L-cWW-L-L
Group 354 is from IL_85222.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85222.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGCACUC*GUUGC (   1) MLPS  -8.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85222.1  4LFB G 1143 C 1128'

 matches the original group, cWW-L-R-L-R-L-cWW-L-L
Group 405 is from IL_97697.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_97697.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       AACUGAAU*ACAUU (   1) MLPS  -7.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_97697.1  5M0I A    4 U   22'

 matches the original group, cWW-L-R-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00       AACUGAAU*ACAUU (   1) MLPS  -7.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_97697.1  5M0J A    4 U   22'

 matches the original group, cWW-L-R-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00       AACUGAAU*ACAUU (   1) MLPS  -7.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_97697.1  5M0J A    4 U   22'

 matches the original group, cWW-L-R-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00       AACUGAAU*ACAUU (   1) MLPS  -7.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_97697.1  5M0I A    4 U   22'

 matches the original group, cWW-L-R-L-R-L-cWW-L-L
Group  39 is from IL_09570.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09570.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-R-L-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGCCGUGC*GAGC (   1) MLPS  -8.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09570.1  1YLS G  207 C  105'

 matches the original group, cWW-L-R-L-R-L-cWW-L-L-R
Group 333 is from IL_81392.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_81392.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-L-R-L-cWW-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CCCCUUUCCG*CUACACACUG (   1) MLPS -16.21 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_81392.1  6LT7 C   52 G   37'

 matches the original group, cWW-L-R-L-R-L-cWW-L-L-R-L
Group  26 is from IL_06029.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06029.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-L-R-L-R-L-cWW-L-L-R-L-R-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CCGACCUUGAAAUACC*GGGAGG (   1) MLPS -15.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_06029.1  5J7L C 2160 G 2128'

 matches the original group, cWW-L-R-L-R-L-cWW-L-L-R-L-R-L-R-L
Group 237 is from IL_59258.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_59258.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-R-L-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GAUGAAA*UAACC (   1) MLPS  -7.60 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_59258.1  5XTM G    8 C   39'

 matches the original group, cWW-L-R-L-R-L-cWW-L-cWW
Group  80 is from IL_19516.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_19516.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-L-R-L-R-L-cWW-L-cWW-L-L-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GGGGACCUACCCAC*GGAAC (   1) MLPS -13.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_19516.1  8T29 G   17 C   50'

 matches the original group, cWW-L-R-L-R-L-cWW-L-cWW-L-L-L-R-L-R
Group 389 is from IL_94351.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_94351.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CUUGAA*UGGCG (   1) MLPS  -8.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_94351.1  1OOA C    5 G   25'

 matches the original group, cWW-L-R-L-R-L-tHS-cWW
Group 404 is from IL_97631.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_97631.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         ACGAAU*AGACU (   1) MLPS  -7.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_97631.1  4V9F A  562 U  595'

 matches the original group, cWW-L-R-L-R-L-tHS-cWW
Group 247 is from IL_61286.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_61286.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-L-R-L-tWH-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CAUAGUAC*GGAAGG (   1) MLPS  -7.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61286.1  3IGI C  296 G  321'

 matches the original group, cWW-L-R-L-R-L-tWH-L-tHS-cWW
Group 239 is from IL_59724.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_59724.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-L-R-L-R-cSH-tWH-tHS-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CCAGUACG*CCGACCG (   1) MLPS  -6.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_59724.1  4V9F C  355 G  296'

 matches the original group, cWW-L-R-L-R-cSH-tWH-tHS-R-L-cWW
Group  68 is from IL_16458.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_16458.4
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-L-R-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CUAGUAC*GGACCG (   1) MLPS  -4.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_16458.4  7A0S C 2631 G 2647'

 matches the original group, cWW-L-R-L-R-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CUAGUAC*GGACCG (   1) MLPS  -4.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_16458.4  5J7L C 2652 G 2668'

 matches the original group, cWW-L-R-L-R-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CUAGUAC*GGACCG (   1) MLPS  -4.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_16458.4  9DFE C 2652 G 2668'

 matches the original group, cWW-L-R-L-R-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UUAGUAC*GGACCG (   1) MLPS  -5.36 deficit   0.79 prct   0.00 CutScore  96.28;  Ed  0, 0
ans =

    ' IL_16458.4  4WF9 U 2679 G 2695'

 matches the original group, cWW-L-R-L-R-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CCAGUAA*UGACCG (   1) MLPS  -7.22 deficit   2.66 prct   0.00 CutScore  87.50;  Ed  0, 0
ans =

    ' IL_16458.4  4V9F C  585 G  572'

 matches the original group, cWW-L-R-L-R-cSH-tWH-tHS-cWW
Group 123 is from IL_29357.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_29357.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-L-R-L-R-cWH-tHW-cSH-cWW-L-L-cWW-R-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CCCUUGGCAGC*GAUACCAG (   1) MLPS  -7.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_29357.1  8DK7 C   21 G   11'

 matches the original group, cWW-L-R-L-R-cWH-tHW-cSH-cWW-L-L-cWW-R-R
Group  23 is from IL_04785.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_04785.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGAG*CAGGC (   1) MLPS  -6.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04785.1  6DLR G   77 C   96'

 matches the original group, cWW-L-R-L-R-cWW
Better:   3 Equal:   0 Score 0.00            CCCG*CCCG (   1) MLPS  -8.18 deficit   1.45 prct   0.00 CutScore  86.46;  Ed  0, 0
ans =

    ' IL_04785.1  7LIU C  708 G  711'

 scores better against   3 groups: IL_43644.1,  8 NTs, cWW-cWW-L-R-cWW                         , Ed  0, 0, MLPS -6.41, deficit  0.80, prct   0.00; IL_84251.1,  8 NTs, cWW-L-tHS-cWW                           , Ed  2, 0, MLPS -7.55, deficit  0.65, prct   0.00; IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  4, 2, MLPS -7.56, deficit  2.48, prct   0.00; 
Group 270 is from IL_66798.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_66798.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-L-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UUAAG*CGGAG (   1) MLPS  -4.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_66798.2  9DFE U  606 G  622'

 matches the original group, cWW-L-R-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UUAAG*CGGAG (   1) MLPS  -4.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_66798.2  7A0S U  616 G  633'

 matches the original group, cWW-L-R-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UUAAC*GGGAG (   1) MLPS  -4.84 deficit   0.00 prct   0.00 CutScore  99.98;  Ed  0, 0
ans =

    ' IL_66798.2  5J7L U  606 G  622'

 matches the original group, cWW-L-R-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CUAAC*GGGAG (   1) MLPS  -5.67 deficit   0.83 prct   0.00 CutScore  94.23;  Ed  0, 0
ans =

    ' IL_66798.2  4V9F C  663 G  683'

 matches the original group, cWW-L-R-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UUAAG*UGGAG (   1) MLPS  -5.68 deficit   0.84 prct   0.00 CutScore  94.13;  Ed  0, 0
ans =

    ' IL_66798.2  4WF9 U  649 G  667'

 matches the original group, cWW-L-R-L-R-tHS-cWW
Better:   1 Equal:   0 Score 0.00          CGAAU*AGGAG (   1) MLPS  -7.03 deficit   2.19 prct   0.00 CutScore  84.73;  Ed  0, 0
ans =

    ' IL_66798.2  4WF9 C 1909 G 1887'

 scores better against   1 groups: IL_50730.2, 10 NTs, cWW-tSH-tHS-tHS-cWW                     , Ed  2, 0, MLPS -6.55, deficit  0.18, prct   0.00; 
Group 373 is from IL_89021.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_89021.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-L-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UUAAG*CGAAG (   1) MLPS  -6.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89021.2  4WF9 U 1878 G 1918'

 matches the original group, cWW-L-R-L-R-tHS-cWW
Better:   1 Equal:   0 Score 0.00          CUAAG*CGAUG (   1) MLPS  -6.48 deficit   0.47 prct   0.00 CutScore  96.25;  Ed  0, 0
ans =

    ' IL_89021.2  4WF9 C 1388 G 1417'

 scores better against   1 groups: IL_38507.2,  9 NTs, cWW-tWH-L-tHS-cWW                       , Ed  0, 0, MLPS -6.11, deficit  1.02, prct   0.00; 
Better:   1 Equal:   0 Score 0.00          CUAAG*CGAUG (   1) MLPS  -6.48 deficit   0.47 prct   0.00 CutScore  96.25;  Ed  0, 0
ans =

    ' IL_89021.2  7A0S C 1364 G 1393'

 scores better against   1 groups: IL_38507.2,  9 NTs, cWW-tWH-L-tHS-cWW                       , Ed  0, 0, MLPS -6.11, deficit  1.02, prct   0.00; 
Better:   1 Equal:   0 Score 0.00          CUAAG*CGAUG (   1) MLPS  -6.48 deficit   0.47 prct   0.00 CutScore  96.25;  Ed  0, 0
ans =

    ' IL_89021.2  5J7L C 1351 G 1380'

 scores better against   1 groups: IL_38507.2,  9 NTs, cWW-tWH-L-tHS-cWW                       , Ed  0, 0, MLPS -6.11, deficit  1.02, prct   0.00; 
Better:   0 Equal:   0 Score 1.00          UCAAG*CGAAG (   1) MLPS  -6.75 deficit   0.74 prct   0.00 CutScore  94.15;  Ed  0, 0
ans =

    ' IL_89021.2  9DFE U 1851 G 1891'

 matches the original group, cWW-L-R-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAAG*UGAAG (   1) MLPS  -7.73 deficit   1.72 prct   0.00 CutScore  86.38;  Ed  0, 0
ans =

    ' IL_89021.2  7A0S U 1843 G 1874'

 matches the original group, cWW-L-R-L-R-tHS-cWW
Group 245 is from IL_61249.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_61249.1
This group is considered to be structured ***************************
Number of NTs: 20  Signature: cWW-L-R-L-R-tHS-cWW-cWW-tSH-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 UUAAUUGAUG*UUGAUCGAAG (   1) MLPS -10.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61249.1  5J7L U 1851 G 1891'

 matches the original group, cWW-L-R-L-R-tHS-cWW-cWW-tSH-tHS-cWW-cWW
Group 152 is from IL_37752.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_37752.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-R-tHW-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     ACUAUACCG*CUGCCU (   1) MLPS  -7.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_37752.1  8EPK A    5 U   26'

 matches the original group, cWW-L-R-L-R-tHW-R-L-cWW
Group 216 is from IL_54041.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_54041.2
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-R-tWH-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GAGAUAGC*GAAAC (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_54041.2  5J7L G  799 C  678'

 matches the original group, cWW-L-R-L-R-tWH-L-cWW
Better:   0 Equal:   0 Score 1.00       GAGAUAGC*GAAAC (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_54041.2  9DFE G  799 C  678'

 matches the original group, cWW-L-R-L-R-tWH-L-cWW
Better:   0 Equal:   0 Score 1.00       GAGAUAGC*GAAAC (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_54041.2  4WF9 G  844 C  723'

 matches the original group, cWW-L-R-L-R-tWH-L-cWW
Better:   0 Equal:   0 Score 1.00       GAGAUAGC*GAAAC (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_54041.2  7A0S G  812 C  691'

 matches the original group, cWW-L-R-L-R-tWH-L-cWW
Better:   0 Equal:   0 Score 1.00       CUAGUAGC*GAAAG (   1) MLPS  -9.68 deficit   3.63 prct   0.00 CutScore  81.84;  Ed  0, 0
ans =

    ' IL_54041.2  8P9A C  931 G  809'

 matches the original group, cWW-L-R-L-R-tWH-L-cWW
Better:   0 Equal:   0 Score 1.00       CUAGUAGC*GAAAG (   1) MLPS  -9.68 deficit   3.63 prct   0.00 CutScore  81.84;  Ed  0, 0
ans =

    ' IL_54041.2  8CRE C  927 G  805'

 matches the original group, cWW-L-R-L-R-tWH-L-cWW
Better:   0 Equal:   0 Score 1.00       GCAACAGC*GAAUC (   1) MLPS -10.63 deficit   4.58 prct   0.00 CutScore  77.09;  Ed  0, 0
ans =

    ' IL_54041.2  4V9F G  892 C  769'

 matches the original group, cWW-L-R-L-R-tWH-L-cWW
Group  42 is from IL_09990.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09990.4
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GACU*ACC (   1) MLPS  -4.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09990.4  4V9F G 1475 C 1467'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             GCCC*GGC (   1) MLPS  -6.30 deficit   1.85 prct   0.00 CutScore  80.52;  Ed  0, 0
ans =

    ' IL_09990.4  4WSM G   46 C   57'

 matches the original group, cWW-L-R-L-cWW
Group  58 is from IL_14177.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_14177.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CCUAAG*UAG (   1) MLPS  -5.31 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_14177.2  4LFB C   47 G  361'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           CCUAAC*GGG (   1) MLPS  -5.64 deficit   0.33 prct   0.00 CutScore  97.66;  Ed  0, 0
ans =

    ' IL_14177.2  5J7L C   47 G  361'

 matches the original group, cWW-L-R-L-cWW
Group  64 is from IL_15698.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_15698.3
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CAAC*GUG (   1) MLPS  -4.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15698.3  5FJC C   44 G   58'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             CAAC*GUG (   1) MLPS  -4.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15698.3  4OQU C   24 G   48'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             CAAC*GUG (   1) MLPS  -4.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15698.3  4AOB C   44 G   58'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             CAAC*GUG (   1) MLPS  -4.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15698.3  3V7E C   44 G   90'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             CAAC*GUG (   1) MLPS  -4.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15698.3  4KQY C   45 G   79'

 matches the original group, cWW-L-R-L-cWW
Better:   1 Equal:   0 Score 0.00             GAUA*UGC (   1) MLPS  -6.13 deficit   1.65 prct   0.00 CutScore  83.92;  Ed  0, 0
ans =

    ' IL_15698.3  8P9A G 1618 C 1826'

 scores better against   1 groups: IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.72, deficit  0.81, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             GAUA*UGC (   1) MLPS  -6.13 deficit   1.65 prct   0.00 CutScore  83.92;  Ed  0, 0
ans =

    ' IL_15698.3  8CRE G 1614 C 1822'

 scores better against   1 groups: IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.72, deficit  0.81, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             CAUG*UGG (   1) MLPS  -7.57 deficit   3.09 prct   0.00 CutScore  69.90;  Ed  0, 0
ans =

    ' IL_15698.3  8P9A C  270 G  285'

 scores better against   1 groups: IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.93, deficit  2.02, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             CAUG*UGG (   1) MLPS  -7.57 deficit   3.09 prct   0.00 CutScore  69.90;  Ed  0, 0
ans =

    ' IL_15698.3  8CRE C  268 G  283'

 scores better against   1 groups: IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.93, deficit  2.02, prct   0.00; 
Better:   5 Equal:   0 Score 0.00           GAACAA*UAC (   1) MLPS -11.45 deficit   6.97 prct   0.00 CutScore  31.99;  Ed  0, 0
ans =

    ' IL_15698.3  5DO4 G    3 C   23'

 scores better against   5 groups: IL_98347.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 1, MLPS -7.85, deficit  1.10, prct   0.00; IL_33323.1,  9 NTs, cWW-L-R-L-cWW-L-L                       , Ed  6, 2, MLPS -8.10, deficit  1.62, prct   0.00; IL_59302.1,  9 NTs, cWW-L-R-L-cWW-L                         , Ed  5, 1, MLPS -8.30, deficit  1.88, prct   0.00; IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  0, 0, MLPS -9.73, deficit  4.11, prct   0.00; IL_69440.3,  8 NTs, cWW-L-R-cSH-cWW                         , Ed  3, 1, MLPS -10.59, deficit  5.66, prct   0.00; 
Group  79 is from IL_19102.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_19102.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UAUAU*AGG (   1) MLPS  -6.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_19102.1  4PMI U   41 G   77'

 matches the original group, cWW-L-R-L-cWW
Better:   1 Equal:   0 Score 0.00            CCCAG*CAG (   1) MLPS  -7.67 deficit   1.31 prct   0.00 CutScore  87.14;  Ed  0, 0
ans =

    ' IL_19102.1  9IWF C   58 G   42'

 scores better against   1 groups: IL_44325.1,  6 NTs, cWW-cWH-cWW-L                           , Ed  3, 1, MLPS -6.99, deficit  1.17, prct   0.00; 
Group 118 is from IL_28564.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_28564.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UAAA*UCUG (   1) MLPS  -4.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28564.1  6DTD U   28 G   11'

 matches the original group, cWW-L-R-L-cWW
Group 131 is from IL_31531.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31531.3
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GAAG*CAC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31531.3  2ET8 G   38 C    8'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             GAAG*CAC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31531.3  2O3X G   39 C    9'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             GAAG*CAC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31531.3  4LFB G 1491 C 1409'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             GAAG*CAC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31531.3  1ZZ5 G    7 C   28'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             GAAG*CAC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31531.3  4PDQ G   39 C    9'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             GAAG*CAC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31531.3  3C3Z G    7 C   17'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             GAAG*CAC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31531.3  1T0E G    7 C   18'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             GAAG*CAC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31531.3  1ZX7 G    7 C   28'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             UAAC*GAG (   1) MLPS  -4.37 deficit   0.95 prct   0.00 CutScore  90.03;  Ed  0, 0
ans =

    ' IL_31531.3  5J7L U 1445 G 1457'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00             UAAC*GAG (   1) MLPS  -4.37 deficit   0.95 prct   0.00 CutScore  90.03;  Ed  0, 0
ans =

    ' IL_31531.3  3NDB U  175 G  154'

 matches the original group, cWW-L-R-L-cWW
Better:   1 Equal:   0 Score 0.00             AAAG*CGU (   1) MLPS  -5.34 deficit   1.92 prct   0.00 CutScore  79.82;  Ed  0, 0
ans =

    ' IL_31531.3  4ZC7 A   16 U   32'

 scores better against   1 groups: IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.32, deficit  0.41, prct   0.00; 
Better:   0 Equal:   0 Score 1.00             UGAC*GAG (   1) MLPS  -5.90 deficit   2.47 prct   0.00 CutScore  73.96;  Ed  0, 0
ans =

    ' IL_31531.3  4WF9 U 2891 G 2865'

 matches the original group, cWW-L-R-L-cWW
Better:   1 Equal:   0 Score 0.00             GGAC*GGC (   1) MLPS  -6.70 deficit   3.27 prct   0.00 CutScore  65.58;  Ed  0, 0
ans =

    ' IL_31531.3  7A0S G 2846 C 2820'

 scores better against   1 groups: IL_15698.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -4.87, deficit  0.39, prct   0.00; 
Group 160 is from IL_41344.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_41344.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   9 Equal:   0 Score 0.00             GAAG*CAC (   1) MLPS  -7.00 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_41344.1  4PDQ G   16 C   32'

 scores better against   9 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.58, deficit  0.67, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -5.59, deficit -0.13, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -5.65, deficit  0.07, prct   0.00; IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -6.27, deficit  1.44, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            UCUA*UUAG (   1) MLPS  -7.36 deficit   0.35 prct   0.00 CutScore  96.28;  Ed  0, 0
ans =

    ' IL_41344.1  3PDR U  159 G   26'

 scores better against   1 groups: IL_91920.1,  8 NTs, cWW-cWW-tHH-cWW                         , Ed  4, 2, MLPS -7.25, deficit  2.64, prct   0.00; 
Group 166 is from IL_42314.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_42314.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UGUAA*UGA (   1) MLPS  -5.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42314.1  4KQY U   52 A   71'

 matches the original group, cWW-L-R-L-cWW
Group 210 is from IL_51479.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_51479.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00           CGCU*AAAAG (   1) MLPS  -6.99 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51479.1  2OE8 C 1407 G 1494'

 scores better against   1 groups: IL_62012.1,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  0, 0, MLPS -6.38, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CGCU*AAAAG (   1) MLPS  -6.99 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51479.1  2OE5 C 1407 G 1494'

 scores better against   1 groups: IL_62012.1,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  0, 0, MLPS -6.38, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CGCU*AAAAG (   1) MLPS  -6.99 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51479.1  2O3Y C   30 G   19'

 scores better against   1 groups: IL_62012.1,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  0, 0, MLPS -6.38, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CGCU*AAAAG (   1) MLPS  -6.99 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51479.1  2O3V C   30 G   19'

 scores better against   1 groups: IL_62012.1,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  0, 0, MLPS -6.38, deficit  0.00, prct   0.00; 
Better:   0 Equal:   0 Score 1.00           CGCC*GCCUG (   1) MLPS  -8.38 deficit   1.38 prct   0.00 CutScore  85.47;  Ed  0, 0
ans =

    ' IL_51479.1  3MEI C    7 G   17'

 matches the original group, cWW-L-R-L-cWW
Better:   4 Equal:   0 Score 0.00            CUUG*CUUG (   1) MLPS  -8.55 deficit   1.55 prct   0.00 CutScore  83.67;  Ed  0, 0
ans =

    ' IL_51479.1  4EYA C    6 G    9'

 scores better against   4 groups: IL_77658.1,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  0, 0, MLPS -4.34, deficit  0.00, prct   0.00; IL_92446.2,  7 NTs, cWW-cWW-R-L-L                           , Ed  3, 1, MLPS -6.86, deficit  2.64, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  3, 2, MLPS -6.87, deficit  2.59, prct   0.00; IL_02203.1,  8 NTs, cWW-cSW-cWW-cWW                         , Ed  3, 1, MLPS -7.87, deficit  3.45, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            CUUG*CUUG (   1) MLPS  -8.55 deficit   1.55 prct   0.00 CutScore  83.67;  Ed  0, 0
ans =

    ' IL_51479.1  4EYA C    6 G    9'

 scores better against   4 groups: IL_77658.1,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  0, 0, MLPS -4.34, deficit  0.00, prct   0.00; IL_92446.2,  7 NTs, cWW-cWW-R-L-L                           , Ed  3, 1, MLPS -6.86, deficit  2.64, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  3, 2, MLPS -6.87, deficit  2.59, prct   0.00; IL_02203.1,  8 NTs, cWW-cSW-cWW-cWW                         , Ed  3, 1, MLPS -7.87, deficit  3.45, prct   0.00; 
Better:   3 Equal:   0 Score 0.00            AGAG*CCGU (   1) MLPS  -9.61 deficit   2.61 prct   0.00 CutScore  72.52;  Ed  0, 0
ans =

    ' IL_51479.1  8CRE A  160 U  150'

 scores better against   3 groups: IL_04785.1,  8 NTs, cWW-L-R-L-R-cWW                         , Ed  5, 3, MLPS -6.69, deficit -0.04, prct   0.00; IL_25872.4,  8 NTs, cWW-cWW-cWH-cWW                         , Ed  4, 2, MLPS -8.39, deficit  2.39, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -9.45, deficit  2.41, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            AAUG*CAUU (   1) MLPS -10.09 deficit   3.10 prct   0.00 CutScore  67.38;  Ed  0, 0
ans =

    ' IL_51479.1  8BH9 A  430 U  503'

 scores better against   4 groups: IL_92446.2,  7 NTs, cWW-cWW-R-L-L                           , Ed  3, 1, MLPS -6.87, deficit  2.65, prct   0.00; IL_43644.1,  8 NTs, cWW-cWW-L-R-cWW                         , Ed  1, 1, MLPS -7.77, deficit  2.16, prct   0.00; IL_78800.1,  6 NTs, cWW-cSH-L-cWW                           , Ed  4, 2, MLPS -8.40, deficit  3.51, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -8.53, deficit  1.49, prct   0.00; 
Better:   2 Equal:   0 Score 0.00            GUGA*UGCC (   1) MLPS -10.29 deficit   3.29 prct   0.00 CutScore  65.33;  Ed  0, 0
ans =

    ' IL_51479.1  4WF9 G    5 C  110'

 scores better against   2 groups: IL_43644.1,  8 NTs, cWW-cWW-L-R-cWW                         , Ed  7, 3, MLPS -6.12, deficit  0.51, prct   0.00; IL_25872.4,  8 NTs, cWW-cWW-cWH-cWW                         , Ed  3, 2, MLPS -7.33, deficit  1.33, prct   0.00; 
Group 249 is from IL_61341.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_61341.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00             UUGU*ACG (   1) MLPS  -6.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61341.1  8CRE U 1036 G 1052'

 scores better against   1 groups: IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  4, 2, MLPS -6.65, deficit  1.79, prct   0.00; 
Better:   3 Equal:   0 Score 0.00            CGAAG*CAG (   1) MLPS  -7.54 deficit   0.60 prct   0.00 CutScore  93.64;  Ed  0, 0
ans =

    ' IL_61341.1  3OXE C   31 G   72'

 scores better against   3 groups: IL_61476.2,  8 NTs, cWW-tSH-L-cWW-L                         , Ed  0, 0, MLPS -6.13, deficit  1.10, prct   0.00; IL_47972.1,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  1, 1, MLPS -6.46, deficit  1.10, prct   0.00; IL_69440.3,  8 NTs, cWW-L-R-cSH-cWW                         , Ed  2, 0, MLPS -6.63, deficit  1.70, prct   0.00; 
Group 289 is from IL_70335.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70335.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UCUAU*ACGA (   1) MLPS  -5.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70335.1  9DFE U 2611 A 2057'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           UCUAU*ACGA (   1) MLPS  -5.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70335.1  7A0S U 2590 A 2040'

 matches the original group, cWW-L-R-L-cWW
Group 312 is from IL_76319.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_76319.5
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UGCAU*AUG (   1) MLPS  -4.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_76319.5  8CRE U 1257 G 1424'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00            UGCAU*AUG (   1) MLPS  -4.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_76319.5  4LFB U 1052 G 1206'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00            UGCAU*AUG (   1) MLPS  -4.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_76319.5  8P9A U 1272 G 1438'

 matches the original group, cWW-L-R-L-cWW
Group 342 is from IL_82706.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82706.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UCUUUGG*CGA (   1) MLPS  -5.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82706.1  8P9A U 1095 A 1036'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00          UCUUUGG*CGA (   1) MLPS  -5.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82706.1  8CRE U 1080 A 1021'

 matches the original group, cWW-L-R-L-cWW
Group 378 is from IL_89984.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_89984.3
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GUACU*AUC (   1) MLPS  -5.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89984.3  2OEU G    5 C   14'

 matches the original group, cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00            GUACA*UUC (   1) MLPS  -5.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89984.3  8SYK G   12 C  111'

 matches the original group, cWW-L-R-L-cWW
Group 380 is from IL_90351.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_90351.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CGAG*CGG (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90351.1  5J7L C   99 G   69'

 matches the original group, cWW-L-R-L-cWW
Better:   3 Equal:   0 Score 0.00             GAAG*CAC (   1) MLPS  -5.65 deficit   0.07 prct   0.00 CutScore  99.26;  Ed  0, 0
ans =

    ' IL_90351.1  2QEK G    7 C   17'

 scores better against   3 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.58, deficit  0.67, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -5.59, deficit -0.13, prct   0.00; 
Better:   3 Equal:   0 Score 0.00             GAAG*CAC (   1) MLPS  -5.65 deficit   0.07 prct   0.00 CutScore  99.26;  Ed  0, 0
ans =

    ' IL_90351.1  5J7L G 1491 C 1409'

 scores better against   3 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.58, deficit  0.67, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -5.59, deficit -0.13, prct   0.00; 
Better:   2 Equal:   0 Score 0.00             AAAC*GCU (   1) MLPS  -6.72 deficit   1.15 prct   0.00 CutScore  87.93;  Ed  0, 0
ans =

    ' IL_90351.1  9DFE A  899 U  877'

 scores better against   2 groups: IL_61438.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -4.66, deficit  1.93, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  4, 1, MLPS -5.82, deficit  0.10, prct   0.00; 
Better:   5 Equal:   0 Score 0.00             UAAC*GUA (   1) MLPS  -7.23 deficit   1.65 prct   0.00 CutScore  82.60;  Ed  0, 0
ans =

    ' IL_90351.1  8P9A U  533 A  518'

 scores better against   5 groups: IL_15698.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 0, MLPS -4.80, deficit  0.32, prct   0.00; IL_61438.4,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -6.85, deficit  4.12, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 1, MLPS -6.85, deficit -0.19, prct   0.00; IL_61341.1,  6 NTs, cWW-L-R-L-cWW                           , Ed  6, 2, MLPS -6.87, deficit -0.07, prct   0.00; IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -7.18, deficit  3.75, prct   0.00; 
Better:   2 Equal:   0 Score 0.00            GAUGG*CAC (   1) MLPS  -7.42 deficit   1.84 prct   0.00 CutScore  80.58;  Ed  0, 0
ans =

    ' IL_90351.1  3MXH G   94 C   13'

 scores better against   2 groups: IL_19102.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  5, 2, MLPS -6.88, deficit  0.52, prct   0.00; IL_42314.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  7, 3, MLPS -7.12, deficit  1.36, prct   0.00; 
Better:   4 Equal:   0 Score 0.00             UCUC*GAA (   1) MLPS  -7.53 deficit   1.96 prct   0.00 CutScore  79.42;  Ed  0, 0
ans =

    ' IL_90351.1  4WF9 U  480 A   44'

 scores better against   4 groups: IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  3, 1, MLPS -6.56, deficit  0.94, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  2, 2, MLPS -6.61, deficit  0.89, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 1, MLPS -7.00, deficit -0.00, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -7.27, deficit  0.23, prct   0.00; 
Better:   6 Equal:   0 Score 0.00            GAAUG*CGC (   1) MLPS  -8.87 deficit   3.30 prct   0.00 CutScore  65.29;  Ed  0, 0
ans =

    ' IL_90351.1  8CRE G 2184 C 2215'

 scores better against   6 groups: IL_36516.3,  8 NTs, cWW-cWW-cSH-cWW-L                       , Ed  0, 0, MLPS -6.27, deficit  0.00, prct   0.00; IL_06549.2,  4 NTs, cWW-cWW                                 , Ed  4, 0, MLPS -6.45, deficit  0.43, prct   0.00; IL_57881.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -6.73, deficit  0.15, prct   0.00; IL_66997.2,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  4, 2, MLPS -6.74, deficit  0.85, prct   0.00; IL_83150.2,  7 NTs, cWW-tHH-cWW-L-L                         , Ed  2, 2, MLPS -7.01, deficit  1.16, prct   0.00; 
Group 406 is from IL_98347.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_98347.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GAAAAA*UAC (   1) MLPS  -6.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_98347.1  6RTI G    7 C   37'

 matches the original group, cWW-L-R-L-cWW
Group 407 is from IL_99358.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_99358.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CCAG*CUG (   1) MLPS  -7.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_99358.1  7KJT C   39 G   30'

 matches the original group, cWW-L-R-L-cWW
Better:   2 Equal:   0 Score 0.00             GGUC*GGC (   1) MLPS  -7.10 deficit   0.06 prct   0.00 CutScore  99.42;  Ed  0, 0
ans =

    ' IL_99358.1  8CRE G  495 C  487'

 scores better against   2 groups: IL_15698.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -5.47, deficit  0.99, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  3, 0, MLPS -5.69, deficit  1.22, prct   0.00; 
Better:   3 Equal:   0 Score 0.00             GAUG*CCC (   1) MLPS  -7.14 deficit   0.10 prct   0.00 CutScore  98.99;  Ed  0, 0
ans =

    ' IL_99358.1  4N0T G   78 C   68'

 scores better against   3 groups: IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 2, MLPS -6.37, deficit  0.66, prct   0.00; IL_61438.4,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -6.64, deficit  3.91, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -6.84, deficit  1.26, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             UGUG*CUG (   1) MLPS  -7.15 deficit   0.11 prct   0.00 CutScore  98.86;  Ed  0, 0
ans =

    ' IL_99358.1  4QIK U   11 G   12'

 scores better against   1 groups: IL_51387.2,  7 NTs, cWW-cSH-cWW-cWW                         , Ed  2, 0, MLPS -6.34, deficit  1.39, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             AUAG*CUU (   1) MLPS  -7.57 deficit   0.52 prct   0.00 CutScore  94.49;  Ed  0, 0
ans =

    ' IL_99358.1  6ZDU A 1283 U 1270'

 scores better against   1 groups: IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -7.03, deficit  1.89, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             UCCG*CAG (   1) MLPS  -8.59 deficit   1.54 prct   0.00 CutScore  83.75;  Ed  0, 0
ans =

    ' IL_99358.1  6VMY U  219 G  232'

 scores better against   1 groups: IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -7.76, deficit  0.76, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            GAAA*UCGC (   1) MLPS  -9.13 deficit   2.09 prct   0.00 CutScore  78.01;  Ed  0, 0
ans =

    ' IL_99358.1  7MLW G   89 C   76'

 scores better against   4 groups: IL_02203.1,  8 NTs, cWW-cSW-cWW-cWW                         , Ed  7, 3, MLPS -7.28, deficit  2.87, prct   0.00; IL_80398.1,  8 NTs, cWW-L-cSW-L-R-cWW                       , Ed  6, 2, MLPS -7.79, deficit  2.52, prct   0.00; IL_85033.2,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  4, 2, MLPS -7.90, deficit  1.56, prct   0.00; IL_25872.4,  8 NTs, cWW-cWW-cWH-cWW                         , Ed  3, 1, MLPS -8.32, deficit  2.31, prct   0.00; 
Better:   3 Equal:   0 Score 0.00            GAUC*GAAC (   1) MLPS  -8.82 deficit   1.78 prct   0.00 CutScore  81.24;  Ed  0, 0
ans =

    ' IL_99358.1  4PHY G   17 C   34'

 scores better against   3 groups: IL_80398.1,  8 NTs, cWW-L-cSW-L-R-cWW                       , Ed  3, 1, MLPS -6.59, deficit  1.32, prct   0.00; IL_48444.6,  8 NTs, cWW-L-R-cWW-cWW                         , Ed  5, 1, MLPS -8.29, deficit  0.48, prct   0.00; IL_43644.1,  8 NTs, cWW-cWW-L-R-cWW                         , Ed  6, 2, MLPS -8.44, deficit  2.83, prct   0.00; 
Group  33 is from IL_07173.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_07173.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           AUAGUC*GCU (   1) MLPS  -6.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07173.1  8CRE A 1355 U 1338'

 matches the original group, cWW-L-R-L-cWW-L
Group  50 is from IL_11415.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_11415.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UUCCG*UGA (   1) MLPS  -4.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_11415.1  8P9A U 1014 A 1036'

 matches the original group, cWW-L-R-L-cWW-L
Group 193 is from IL_47972.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47972.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CGAUG*CAG (   1) MLPS  -5.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_47972.1  5J7L C  366 G  271'

 matches the original group, cWW-L-R-L-cWW-L
Group 196 is from IL_49061.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_49061.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00            CCGAG*CAG (   1) MLPS  -7.25 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_49061.1  1XJR C    9 G   41'

 scores better against   1 groups: IL_44325.1,  6 NTs, cWW-cWH-cWW-L                           , Ed  3, 1, MLPS -6.99, deficit  1.17, prct   0.00; 
Better:   5 Equal:   0 Score 0.00            GGAAG*CAC (   1) MLPS  -7.66 deficit   0.41 prct   0.00 CutScore  95.64;  Ed  0, 0
ans =

    ' IL_49061.1  4GXY G  122 C  107'

 scores better against   5 groups: IL_66997.2,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  3, 2, MLPS -5.96, deficit  0.07, prct   0.00; IL_61476.2,  8 NTs, cWW-tSH-L-cWW-L                         , Ed  2, 0, MLPS -6.27, deficit  1.24, prct   0.00; IL_47972.1,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  3, 1, MLPS -6.54, deficit  1.17, prct   0.00; IL_69440.3,  8 NTs, cWW-L-R-cSH-cWW                         , Ed  4, 0, MLPS -6.79, deficit  1.86, prct   0.00; IL_83150.2,  7 NTs, cWW-tHH-cWW-L-L                         , Ed  1, 1, MLPS -7.46, deficit  1.61, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            GGAUC*GAC (   1) MLPS  -8.35 deficit   1.10 prct   0.00 CutScore  88.38;  Ed  0, 0
ans =

    ' IL_49061.1  4WF9 G  409 C  306'

 scores better against   4 groups: IL_47972.1,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  4, 0, MLPS -5.51, deficit  0.15, prct   0.00; IL_36516.3,  8 NTs, cWW-cWW-cSH-cWW-L                       , Ed  0, 0, MLPS -6.66, deficit  0.39, prct   0.00; IL_66997.2,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  2, 2, MLPS -6.99, deficit  1.10, prct   0.00; IL_61476.2,  8 NTs, cWW-tSH-L-cWW-L                         , Ed  5, 1, MLPS -8.01, deficit  2.98, prct   0.00; 
Better:   2 Equal:   0 Score 0.00           CGGGAG*CAG (   1) MLPS  -8.68 deficit   1.43 prct   0.00 CutScore  84.94;  Ed  0, 0
ans =

    ' IL_49061.1  4LFB C 1440 G 1461'

 scores better against   2 groups: IL_94684.1,  9 NTs, cWW-tWH-R-L-cWW-L-L                     , Ed  4, 2, MLPS -6.99, deficit  3.35, prct   0.00; IL_19668.1,  8 NTs, cWW-cWW-L-cWW-L                         , Ed  6, 2, MLPS -7.86, deficit  0.20, prct   0.00; 
Better:   3 Equal:   0 Score 0.00           CGGAAA*UGG (   1) MLPS  -8.81 deficit   1.56 prct   0.00 CutScore  83.53;  Ed  0, 0
ans =

    ' IL_49061.1  5UNE C   33 G   12'

 scores better against   3 groups: IL_69000.1,  9 NTs, cWW-L-cWW-L-cWW-L                       , Ed  7, 3, MLPS -7.36, deficit  1.96, prct   0.00; IL_61299.4,  9 NTs, cWW-L-R-L-cWW-L-L                       , Ed  0, 0, MLPS -7.66, deficit  1.68, prct   0.00; IL_14177.2,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -8.79, deficit  3.48, prct   0.00; 
Better:   2 Equal:   0 Score 0.00          UCUGUGA*UGG (   1) MLPS -14.33 deficit   7.09 prct   0.00 CutScore  25.42;  Ed  0, 0
ans =

    ' IL_49061.1  8P9A U 1430 G 1278'

 scores better against   2 groups: IL_82706.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 1, MLPS -9.15, deficit  3.17, prct   0.00; IL_51191.1,  9 NTs, cWW-L-R-L-cWW-L-L                       , Ed  6, 3, MLPS -13.71, deficit  6.78, prct   0.00; 
Group 238 is from IL_59302.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_59302.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UACAAG*CGA (   1) MLPS  -6.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_59302.1  4V9F U  548 A  608'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00           UACCAG*CAA (   1) MLPS  -6.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_59302.1  3LQX U  139 A  169'

 matches the original group, cWW-L-R-L-cWW-L
Group 271 is from IL_66997.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_66997.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GGACC*GGC (   1) MLPS  -5.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_66997.2  5J7L G  203 C  214'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00           GAAAU*ACAC (   1) MLPS  -6.27 deficit   0.38 prct   0.00 CutScore  96.59;  Ed  0, 0
ans =

    ' IL_66997.2  4YAZ G   77 C    7'

 matches the original group, cWW-L-R-L-cWW-L
Group 303 is from IL_73789.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_73789.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CGAUUC*GGG (   1) MLPS  -4.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_73789.1  8CRE C  374 G  363'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00           CGAUUC*GGG (   1) MLPS  -4.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_73789.1  8P9A C  376 G  365'

 matches the original group, cWW-L-R-L-cWW-L
Group 341 is from IL_82683.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82683.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  7QQX C   40 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  7QR0 C   40 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  5FQ5 C   40 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  5B2T C   40 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  7QQP C   40 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  7ZO1 C   40 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  7QR8 C   40 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  5VW1 C   40 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  5F9R C   58 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  8KAJ C   40 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGUU*AGAG (   1) MLPS  -3.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82683.2  8KAL C   40 G   29'

 matches the original group, cWW-L-R-L-cWW-L
Group 139 is from IL_33323.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_33323.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CAGAAG*CAG (   1) MLPS  -6.47 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_33323.1  5J7L C  492 G  442'

 matches the original group, cWW-L-R-L-cWW-L-L
Better:   1 Equal:   0 Score 0.00           CCCUUG*CAG (   1) MLPS  -8.11 deficit   1.64 prct   0.00 CutScore  87.60;  Ed  0, 0
ans =

    ' IL_33323.1  8D28 C   20 G   11'

 scores better against   1 groups: IL_10389.1,  8 NTs, cWW-L-cWW-L-cWW                         , Ed  0, 0, MLPS -8.08, deficit  1.18, prct   0.00; 
Group 158 is from IL_38969.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_38969.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CGCUUUUUG*CAG (   1) MLPS  -8.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38969.1  6N5P C   36 G   99'

 matches the original group, cWW-L-R-L-cWW-L-L
Group 206 is from IL_51191.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_51191.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CAGGUGU*AAG (   1) MLPS  -6.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51191.1  6OL3 C  122 G   37'

 matches the original group, cWW-L-R-L-cWW-L-L
Group 248 is from IL_61299.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_61299.4
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UCUAAG*CUG (   1) MLPS  -5.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61299.4  8P9A U   58 G   89'

 matches the original group, cWW-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00           UCUAAG*CUG (   1) MLPS  -5.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61299.4  8CRE U   58 G   89'

 matches the original group, cWW-L-R-L-cWW-L-L
Better:   1 Equal:   0 Score 0.00           CGGAAA*UGG (   1) MLPS  -7.66 deficit   1.68 prct   0.00 CutScore  86.74;  Ed  0, 0
ans =

    ' IL_61299.4  5UNE C   33 G   12'

 scores better against   1 groups: IL_69000.1,  9 NTs, cWW-L-cWW-L-cWW-L                       , Ed  7, 3, MLPS -7.36, deficit  1.96, prct   0.00; 
Group 315 is from IL_76758.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_76758.2
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          ACUCGG*CUGU (   1) MLPS  -4.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_76758.2  4WF9 A 1713 U 2020'

 matches the original group, cWW-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00          AGUCGG*CUGU (   1) MLPS  -5.34 deficit   0.68 prct   0.00 CutScore  96.17;  Ed  0, 0
ans =

    ' IL_76758.2  8CRE A 1897 U 2314'

 matches the original group, cWW-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00          AGUCGG*CUGU (   1) MLPS  -5.34 deficit   0.68 prct   0.00 CutScore  96.17;  Ed  0, 0
ans =

    ' IL_76758.2  8P9A A 1901 U 2336'

 matches the original group, cWW-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00          ACUCUG*CUGU (   1) MLPS  -5.45 deficit   0.79 prct   0.00 CutScore  95.53;  Ed  0, 0
ans =

    ' IL_76758.2  9DFE A 1669 U 1993'

 matches the original group, cWW-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00          ACUAGG*CUGU (   1) MLPS  -5.96 deficit   1.30 prct   0.00 CutScore  92.63;  Ed  0, 0
ans =

    ' IL_76758.2  5J7L A 1669 U 1993'

 matches the original group, cWW-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00          AUUCGG*CUGU (   1) MLPS  -6.00 deficit   1.34 prct   0.00 CutScore  92.43;  Ed  0, 0
ans =

    ' IL_76758.2  4V9F A 1747 U 2034'

 matches the original group, cWW-L-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00          ACUUUG*CUGU (   1) MLPS  -6.75 deficit   2.09 prct   0.00 CutScore  88.15;  Ed  0, 0
ans =

    ' IL_76758.2  7A0S A 1686 U 1976'

 matches the original group, cWW-L-R-L-cWW-L-L
Group 379 is from IL_90346.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_90346.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CUAAGC*GAAG (   1) MLPS  -6.91 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90346.1  7KVT C   67 G   50'

 matches the original group, cWW-L-R-L-cWW-L-L
Group 220 is from IL_54896.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_54896.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-cWW-L-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00       UGGCGAACAG*CGG (   1) MLPS  -9.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_54896.1  4XWF U   11 G   35'

 scores better against   1 groups: IL_85498.1, 12 NTs, cWW-L-R-L-cWW-L-L-R-L-R                 , Ed  0, 0, MLPS -8.59, deficit  0.00, prct   0.00; 
Group 355 is from IL_85498.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85498.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-cWW-L-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UGGCGAACAG*CGG (   1) MLPS  -8.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85498.1  8VVJ U   11 G   35'

 matches the original group, cWW-L-R-L-cWW-L-L-R-L-R
Group 372 is from IL_88974.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_88974.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-cWW-L-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UCGCGAGCAC*GGA (   1) MLPS  -7.25 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88974.1  7JRT U   77 A  125'

 matches the original group, cWW-L-R-L-cWW-L-L-R-L-R
Better:   0 Equal:   0 Score 1.00       UCGCGAGCAC*GGA (   1) MLPS  -7.25 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88974.1  7JRT U   77 A  125'

 matches the original group, cWW-L-R-L-cWW-L-L-R-L-R
Group  17 is from IL_04332.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_04332.3
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-L-cWW-L-L-R-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    CGUAGUACCUUG*CUUG (   1) MLPS  -8.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04332.3  4V9F C 1975 G 2005'

 matches the original group, cWW-L-R-L-cWW-L-L-R-L-R-L
Better:   1 Equal:   0 Score 0.00    CGAAAUUCCUUG*CCUG (   1) MLPS -10.37 deficit   1.59 prct   0.00 CutScore  92.92;  Ed  0, 0
ans =

    ' IL_04332.3  7A0S C 1917 G 1947'

 scores better against   1 groups: IL_42218.2, 13 NTs, cWW-L-R-cHW-cWW-L-L-L-R-L               , Ed  0, 0, MLPS -8.51, deficit  0.34, prct   0.00; 
Group 368 is from IL_88072.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_88072.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-L-cWW-L-L-R-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       AAAAGCAUAG*CCU (   1) MLPS  -6.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88072.1  4FRG A    6 U   78'

 matches the original group, cWW-L-R-L-cWW-L-L-R-L-R-L
Group 165 is from IL_42231.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_42231.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-R-L-cWW-L-cWW-cSS-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   UACGAAUAAG*CGCUGGA (   1) MLPS -10.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42231.1  8CRE U 3149 A 3175'

 matches the original group, cWW-L-R-L-cWW-L-cWW-cSS-L
Better:   0 Equal:   0 Score 1.00   UACGAAUAAG*CGCUGAA (   1) MLPS -10.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42231.1  8P9A U 3179 A 3210'

 matches the original group, cWW-L-R-L-cWW-L-cWW-cSS-L
Group 301 is from IL_73700.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_73700.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-L-cWW-L-cWW-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    CGCUUUUUGG*CGACAG (   1) MLPS  -9.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_73700.1  6N5P C   36 G   99'

 matches the original group, cWW-L-R-L-cWW-L-cWW-tHS-cWW
Group 121 is from IL_29223.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_29223.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-R-L-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UUAUUU*AUUCA (   1) MLPS  -6.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_29223.1  8P9A U  117 A  299'

 matches the original group, cWW-L-R-L-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00         UUAUUU*AUUCA (   1) MLPS  -6.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_29223.1  8CRE U  117 A  297'

 matches the original group, cWW-L-R-L-cWW-cWW-cWW
Group 191 is from IL_47108.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47108.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-tHH-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGAAAG*UUAA (   1) MLPS  -6.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_47108.1  5Y7M U   39 A   11'

 matches the original group, cWW-L-R-L-tHH-L-cWW
Group 320 is from IL_77870.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_77870.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-L-tHS-L-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CCUGAAUC*GUGAG (   1) MLPS  -8.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77870.1  5J7L C  274 G  363'

 matches the original group, cWW-L-R-L-tHS-L-cWW-L-cWW
Better:   0 Equal:   0 Score 1.00       CUCUCAUC*GUGCG (   1) MLPS -10.01 deficit   1.81 prct   0.00 CutScore  91.13;  Ed  0, 0
ans =

    ' IL_77870.1  4V9F C  280 G  369'

 matches the original group, cWW-L-R-L-tHS-L-cWW-L-cWW
Group  99 is from IL_23774.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_23774.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GGUAG*UGUAC (   1) MLPS  -7.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_23774.1  4V9F G 2754 C 2728'

 matches the original group, cWW-L-R-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GGUAG*UGUAC (   1) MLPS  -7.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_23774.1  4WF9 G 2745 C 2718'

 matches the original group, cWW-L-R-L-tHS-cWW
Better:   2 Equal:   0 Score 0.00           AGAAG*UGGU (   1) MLPS  -8.15 deficit   0.29 prct   0.00 CutScore  96.92;  Ed  0, 0
ans =

    ' IL_23774.1  9DFE A 1469 U 1523'

 scores better against   2 groups: IL_31558.1,  9 NTs, cWW-L-tHS-L-R-cWW                       , Ed  2, 0, MLPS -5.82, deficit  0.10, prct   0.00; IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  3, 1, MLPS -7.44, deficit  2.73, prct   0.00; 
Better:   0 Equal:   0 Score 1.00          GGUAG*UGUUC (   1) MLPS  -8.33 deficit   0.47 prct   0.00 CutScore  95.06;  Ed  0, 0
ans =

    ' IL_23774.1  5J7L G 2718 C 2691'

 matches the original group, cWW-L-R-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UGUAC*GGAG (   1) MLPS  -8.57 deficit   0.71 prct   0.00 CutScore  92.56;  Ed  0, 0
ans =

    ' IL_23774.1  8XZL U    6 G   48'

 matches the original group, cWW-L-R-L-tHS-cWW
Better:   1 Equal:   0 Score 0.00           UGCAC*GGGG (   1) MLPS  -9.14 deficit   1.28 prct   0.00 CutScore  86.49;  Ed  0, 0
ans =

    ' IL_23774.1  8P9A U  741 G  728'

 scores better against   1 groups: IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  3, 1, MLPS -8.64, deficit  3.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           UGCAC*GGGG (   1) MLPS  -9.14 deficit   1.28 prct   0.00 CutScore  86.49;  Ed  0, 0
ans =

    ' IL_23774.1  8CRE U  737 G  726'

 scores better against   1 groups: IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  3, 1, MLPS -8.64, deficit  3.93, prct   0.00; 
Better:   0 Equal:   0 Score 1.00           UGAAG*CGAG (   1) MLPS  -9.33 deficit   1.47 prct   0.00 CutScore  84.51;  Ed  0, 0
ans =

    ' IL_23774.1  5J7L U 1542 G 1529'

 matches the original group, cWW-L-R-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GGUAG*UCUCC (   1) MLPS -10.38 deficit   2.52 prct   0.00 CutScore  73.48;  Ed  0, 0
ans =

    ' IL_23774.1  7A0S G 2698 C 2670'

 matches the original group, cWW-L-R-L-tHS-cWW
Better:   1 Equal:   0 Score 0.00          GGUAG*UUUCC (   1) MLPS -10.39 deficit   2.53 prct   0.00 CutScore  73.33;  Ed  0, 0
ans =

    ' IL_23774.1  9DFE G 2718 C 2691'

 scores better against   1 groups: IL_21001.1,  9 NTs, cWW-L-R-tHW-L-cWW                       , Ed  5, 2, MLPS -9.65, deficit  3.91, prct   0.00; 
Better:   6 Equal:   0 Score 0.00          CCAAG*UGCAG (   1) MLPS -10.41 deficit   2.55 prct   0.00 CutScore  73.18;  Ed  0, 0
ans =

    ' IL_23774.1  2R8S C  216 G  257'

 scores better against   6 groups: IL_89021.2, 10 NTs, cWW-L-R-L-R-tHS-cWW                     , Ed  2, 1, MLPS -7.58, deficit  1.58, prct   0.00; IL_38507.2,  9 NTs, cWW-tWH-L-tHS-cWW                       , Ed  3, 2, MLPS -7.99, deficit  2.90, prct   0.00; IL_61440.1, 10 NTs, cWW-tSH-tHS-tWS-cWW                     , Ed  2, 2, MLPS -9.03, deficit  2.06, prct   0.00; IL_17136.7, 10 NTs, cWW-tSH-tHW-tHS-cWW                     , Ed  3, 1, MLPS -10.01, deficit  3.99, prct   0.00; IL_01038.1, 10 NTs, cWW-tWH-L-R-tHS-cWW                     , Ed  4, 2, MLPS -10.28, deficit  3.48, prct   0.00; 
Group  15 is from IL_04073.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_04073.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-L-R-L-tSH-L-R-cWW-L-R-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 AUAAGGAUUGA*UCUUGAUUU (   1) MLPS -12.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04073.1  8CRE A 1209 U 1244'

 matches the original group, cWW-L-R-L-tSH-L-R-cWW-L-R-R-L-cWW-L
Group 164 is from IL_42218.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_42218.2
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-cHW-cWW-L-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    CGAAAUUCCUUG*CCCG (   1) MLPS  -8.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42218.2  4WF9 C 1961 G 1991'

 matches the original group, cWW-L-R-cHW-cWW-L-L-L-R-L
Better:   0 Equal:   0 Score 1.00    CGAAAUUCCUUG*CCUG (   1) MLPS  -8.51 deficit   0.34 prct   0.00 CutScore  98.37;  Ed  0, 0
ans =

    ' IL_42218.2  5J7L C 1934 G 1964'

 matches the original group, cWW-L-R-cHW-cWW-L-L-L-R-L
Better:   0 Equal:   0 Score 1.00    CGAAAUUCCUUG*CCUG (   1) MLPS  -8.51 deficit   0.34 prct   0.00 CutScore  98.37;  Ed  0, 0
ans =

    ' IL_42218.2  9DFE C 1934 G 1964'

 matches the original group, cWW-L-R-cHW-cWW-L-L-L-R-L
Better:   0 Equal:   0 Score 1.00    CCAAAUGCCUCG*CGCG (   1) MLPS  -9.58 deficit   1.41 prct   0.00 CutScore  93.16;  Ed  0, 0
ans =

    ' IL_42218.2  8CRE C 2255 G 2285'

 matches the original group, cWW-L-R-cHW-cWW-L-L-L-R-L
Better:   0 Equal:   0 Score 1.00    CCAAAUGCCUCG*CGCG (   1) MLPS  -9.58 deficit   1.41 prct   0.00 CutScore  93.16;  Ed  0, 0
ans =

    ' IL_42218.2  8P9A C 2277 G 2307'

 matches the original group, cWW-L-R-cHW-cWW-L-L-L-R-L
Group  93 is from IL_22373.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_22373.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-cSH-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GGUUC*GUC (   1) MLPS  -3.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22373.1  5U3G G   10 C   29'

 matches the original group, cWW-L-R-cSH-cSH-cWW
Better:   0 Equal:   0 Score 1.00            GGUUC*GUC (   1) MLPS  -3.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22373.1  5T83 G   16 C   41'

 matches the original group, cWW-L-R-cSH-cSH-cWW
Better:   0 Equal:   0 Score 1.00            GGUUC*GUC (   1) MLPS  -3.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22373.1  7MLW G   11 C   50'

 matches the original group, cWW-L-R-cSH-cSH-cWW
Better:   0 Equal:   0 Score 1.00            GGUUC*GUC (   1) MLPS  -3.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22373.1  6DLR G   16 C   44'

 matches the original group, cWW-L-R-cSH-cSH-cWW
Group 285 is from IL_69440.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_69440.3
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CGAAA*UAG (   1) MLPS  -4.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69440.3  9DFE C  343 G  295'

 matches the original group, cWW-L-R-cSH-cWW
Better:   0 Equal:   0 Score 1.00            CGAAA*UAG (   1) MLPS  -4.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69440.3  4WF9 C  386 G  338'

 matches the original group, cWW-L-R-cSH-cWW
Better:   0 Equal:   0 Score 1.00            CAAAA*UAG (   1) MLPS  -5.44 deficit   0.51 prct   0.00 CutScore  95.47;  Ed  0, 0
ans =

    ' IL_69440.3  5J7L C  343 G  295'

 matches the original group, cWW-L-R-cSH-cWW
Group  36 is from IL_08770.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_08770.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   2 Equal:   0 Score 0.00              CUG*CAG (   1) MLPS  -6.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_08770.1  9E7E C   28 G   16'

 scores better against   2 groups: IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  1, 1, MLPS -5.06, deficit  0.55, prct   0.00; IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 1, MLPS -5.63, deficit  0.79, prct   0.00; 
Better:   5 Equal:   0 Score 0.00             GAAG*CAC (   1) MLPS  -6.32 deficit   0.30 prct   0.00 CutScore  96.83;  Ed  0, 0
ans =

    ' IL_08770.1  2ET8 G   15 C   31'

 scores better against   5 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.58, deficit  0.67, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -5.59, deficit -0.13, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -5.65, deficit  0.07, prct   0.00; IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -6.27, deficit  1.44, prct   0.00; 
Better:   5 Equal:   0 Score 0.00             GAAG*CAC (   1) MLPS  -6.32 deficit   0.30 prct   0.00 CutScore  96.83;  Ed  0, 0
ans =

    ' IL_08770.1  3LOA G 1491 C 1409'

 scores better against   5 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.58, deficit  0.67, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -5.59, deficit -0.13, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -5.65, deficit  0.07, prct   0.00; IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -6.27, deficit  1.44, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              ACA*UUU (   1) MLPS  -6.45 deficit   0.43 prct   0.00 CutScore  95.43;  Ed  0, 0
ans =

    ' IL_08770.1  8CRE A 1219 U 1236'

 scores better against   2 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.97, deficit  0.00, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -6.20, deficit  1.07, prct   0.00; 
Better:   5 Equal:   0 Score 0.00             ACAG*CGU (   1) MLPS  -8.35 deficit   2.33 prct   0.00 CutScore  75.50;  Ed  0, 0
ans =

    ' IL_08770.1  7A0S A 2579 U 2572'

 scores better against   5 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -6.00, deficit  0.42, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -7.39, deficit  0.35, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -8.11, deficit  2.14, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -8.23, deficit  3.32, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 2, MLPS -8.33, deficit  2.61, prct   0.00; 
Group  47 is from IL_10796.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_10796.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UCG*UCG (   1) MLPS  -3.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10796.1  4O41 U  306 G  409'

 matches the original group, cWW-L-R-cWW
Group 119 is from IL_28788.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_28788.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GGA*UCGAC (   1) MLPS  -5.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28788.1  4ERD G  146 C  123'

 matches the original group, cWW-L-R-cWW
Group 170 is from IL_42997.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_42997.3
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UGU*AUA (   1) MLPS  -4.47 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42997.3  9DFE U  905 A  872'

 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00             CGU*AGUG (   1) MLPS  -5.04 deficit   0.57 prct   0.00 CutScore  93.95;  Ed  0, 0
ans =

    ' IL_42997.3  5J7L C 1196 G 1250'

 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00             CGU*AGUG (   1) MLPS  -5.04 deficit   0.57 prct   0.00 CutScore  93.95;  Ed  0, 0
ans =

    ' IL_42997.3  7A0S C 1210 G 1263'

 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00             CGU*AGUG (   1) MLPS  -5.04 deficit   0.57 prct   0.00 CutScore  93.95;  Ed  0, 0
ans =

    ' IL_42997.3  8CRE C 1372 G 1427'

 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00             CGU*AGUG (   1) MLPS  -5.04 deficit   0.57 prct   0.00 CutScore  93.95;  Ed  0, 0
ans =

    ' IL_42997.3  8P9A C 1376 G 1431'

 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00             CGU*AGUG (   1) MLPS  -5.04 deficit   0.57 prct   0.00 CutScore  93.95;  Ed  0, 0
ans =

    ' IL_42997.3  4WF9 C 1235 G 1288'

 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00             CGU*AGUG (   1) MLPS  -5.04 deficit   0.57 prct   0.00 CutScore  93.95;  Ed  0, 0
ans =

    ' IL_42997.3  9DFE C 1196 G 1250'

 matches the original group, cWW-L-R-cWW
Better:   1 Equal:   0 Score 0.00              CAG*CAG (   1) MLPS  -5.12 deficit   0.66 prct   0.00 CutScore  93.09;  Ed  0, 0
ans =

    ' IL_42997.3  7VFT C    8 G   16'

 scores better against   1 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.88, deficit  0.05, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CAG*CAG (   1) MLPS  -5.12 deficit   0.66 prct   0.00 CutScore  93.09;  Ed  0, 0
ans =

    ' IL_42997.3  3NJ7 C    3 G    8'

 scores better against   1 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.88, deficit  0.05, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CAG*CAG (   1) MLPS  -5.12 deficit   0.66 prct   0.00 CutScore  93.09;  Ed  0, 0
ans =

    ' IL_42997.3  3NJ7 C    3 G    8'

 scores better against   1 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.88, deficit  0.05, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CAG*CAG (   1) MLPS  -5.12 deficit   0.66 prct   0.00 CutScore  93.09;  Ed  0, 0
ans =

    ' IL_42997.3  7VFT C   17 G    7'

 scores better against   1 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.88, deficit  0.05, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              CGA*UCG (   1) MLPS  -5.29 deficit   0.82 prct   0.00 CutScore  91.38;  Ed  0, 0
ans =

    ' IL_42997.3  5E81 C   67 G    6'

 matches the original group, cWW-L-R-cWW
Better:   1 Equal:   0 Score 0.00              AAG*CAU (   1) MLPS  -5.54 deficit   1.08 prct   0.00 CutScore  88.68;  Ed  0, 0
ans =

    ' IL_42997.3  8CRE A  418 U  411'

 scores better against   1 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -5.02, deficit  0.19, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              AAG*CAU (   1) MLPS  -5.54 deficit   1.08 prct   0.00 CutScore  88.68;  Ed  0, 0
ans =

    ' IL_42997.3  8P9A A  420 U  413'

 scores better against   1 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -5.02, deficit  0.19, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              GAC*GAC (   1) MLPS  -5.77 deficit   1.30 prct   0.00 CutScore  86.27;  Ed  0, 0
ans =

    ' IL_42997.3  4V9F G 2237 C 2138'

 scores better against   4 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.75, deficit -0.08, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.62, deficit  1.86, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 1, MLPS -5.65, deficit -0.37, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -5.71, deficit -0.26, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -5.94 deficit   1.47 prct   0.00 CutScore  84.55;  Ed  0, 0
ans =

    ' IL_42997.3  4PCJ C   30 G    6'

 scores better against   4 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.76, deficit  0.00, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.04, deficit -0.09, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -5.06, deficit  0.55, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              GUG*CUC (   1) MLPS  -6.34 deficit   1.88 prct   0.00 CutScore  80.26;  Ed  0, 0
ans =

    ' IL_42997.3  7QR8 G   11 C    9'

 scores better against   4 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.21, deficit  0.41, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -3.90, deficit  0.14, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -5.04, deficit -0.09, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  3, 0, MLPS -5.12, deficit  0.61, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              UUA*UUA (   1) MLPS  -6.55 deficit   2.08 prct   0.00 CutScore  78.11;  Ed  0, 0
ans =

    ' IL_42997.3  2ZI0 U    9 A   11'

 scores better against   4 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.41, deficit  1.61, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  0, 0, MLPS -4.81, deficit  0.31, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.39, deficit  0.25, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.95, deficit  2.19, prct   0.00; 
Better:   6 Equal:   0 Score 0.00              UAU*ACA (   1) MLPS  -6.56 deficit   2.10 prct   0.00 CutScore  77.94;  Ed  0, 0
ans =

    ' IL_42997.3  7A0S U  917 A  885'

 scores better against   6 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.38, deficit  0.20, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 1, MLPS -5.61, deficit -0.41, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.64, deficit  1.88, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -5.75, deficit  2.95, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -5.86, deficit  0.73, prct   0.00; 
Better:   5 Equal:   0 Score 0.00             CGC*GACG (   1) MLPS  -7.69 deficit   3.22 prct   0.00 CutScore  66.08;  Ed  0, 0
ans =

    ' IL_42997.3  4V9F C 1301 G 1354'

 scores better against   5 groups: IL_09990.4,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -6.37, deficit  1.92, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -6.65, deficit  1.73, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 2, MLPS -7.17, deficit  1.15, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 2, MLPS -7.31, deficit  1.74, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -7.63, deficit  1.66, prct   0.00; 
Group 179 is from IL_44465.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_44465.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00              UGA*UGA (   1) MLPS  -3.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_44465.1  1SI2 U  403 A  405'

 scores better against   1 groups: IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  0, 0, MLPS -3.92, deficit  0.94, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UGA*UGA (   1) MLPS  -3.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_44465.1  1SI3 U  403 A  405'

 scores better against   1 groups: IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  0, 0, MLPS -3.92, deficit  0.94, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UGU*AGA (   1) MLPS  -4.20 deficit   0.22 prct   0.00 CutScore  97.63;  Ed  0, 0
ans =

    ' IL_44465.1  8P9A U  150 A  164'

 scores better against   1 groups: IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -3.99, deficit  1.01, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CGG*CGG (   1) MLPS  -4.26 deficit   0.29 prct   0.00 CutScore  96.98;  Ed  0, 0
ans =

    ' IL_44465.1  8P9A C  686 G  648'

 scores better against   1 groups: IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  0, 0, MLPS -2.98, deficit  0.00, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              UGG*UGA (   1) MLPS  -4.53 deficit   0.55 prct   0.00 CutScore  94.18;  Ed  0, 0
ans =

    ' IL_44465.1  5UNE U   39 A    9'

 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00              UGG*UGA (   1) MLPS  -4.53 deficit   0.55 prct   0.00 CutScore  94.18;  Ed  0, 0
ans =

    ' IL_44465.1  5UNE U   39 A    9'

 matches the original group, cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00              CAA*UGG (   1) MLPS  -5.06 deficit   1.09 prct   0.00 CutScore  88.56;  Ed  0, 0
ans =

    ' IL_44465.1  7LYF C   84 G   48'

 matches the original group, cWW-L-R-cWW
Better:   9 Equal:   0 Score 0.00              GUA*UUC (   1) MLPS  -7.31 deficit   3.34 prct   0.00 CutScore  64.86;  Ed  0, 0
ans =

    ' IL_44465.1  7ZO1 G   16 C    5'

 scores better against   9 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.58, deficit  0.78, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -4.97, deficit  0.46, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -5.04, deficit  1.28, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -5.17, deficit  0.04, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.54, deficit  2.08, prct   0.00; 
Better:   3 Equal:   0 Score 0.00             GGAG*CGC (   1) MLPS  -7.95 deficit   3.98 prct   0.00 CutScore  58.12;  Ed  0, 0
ans =

    ' IL_44465.1  9DFE G  931 C  846'

 scores better against   3 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 0, MLPS -6.48, deficit  3.05, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -7.22, deficit  0.17, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  2, 1, MLPS -7.62, deficit  3.15, prct   0.00; 
Group 195 is from IL_48444.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_48444.6
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UAAG*CAGUA (   1) MLPS  -7.82 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_48444.6  1L9A U  117 A  234'

 matches the original group, cWW-L-R-cWW-cWW
Better:   0 Equal:   0 Score 1.00           UAAG*CAGUA (   1) MLPS  -7.82 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_48444.6  1MFQ U  117 A  234'

 matches the original group, cWW-L-R-cWW-cWW
Better:   8 Equal:   0 Score 0.00           CGAU*AGAAG (   1) MLPS  -9.80 deficit   1.99 prct   0.00 CutScore  79.10;  Ed  0, 0
ans =

    ' IL_48444.6  6XJQ C   48 G   14'

 scores better against   8 groups: IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  2, 2, MLPS -7.58, deficit  2.86, prct   0.00; IL_77691.5,  9 NTs, cWW-tSH-L-R-L-cWW                       , Ed  2, 0, MLPS -7.76, deficit  1.03, prct   0.00; IL_83150.2,  7 NTs, cWW-tHH-cWW-L-L                         , Ed  3, 1, MLPS -8.96, deficit  3.11, prct   0.00; IL_85033.2,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  4, 1, MLPS -9.19, deficit  2.85, prct   0.00; IL_71598.1,  8 NTs, cWW-tSH-L-cWW-L                         , Ed  5, 1, MLPS -9.40, deficit  3.18, prct   0.00; 
Better:   4 Equal:   0 Score 0.00          CUAC*GGUCAG (   1) MLPS -11.86 deficit   4.04 prct   0.00 CutScore  57.46;  Ed  0, 0
ans =

    ' IL_48444.6  7A0S C 1514 G 1508'

 scores better against   4 groups: IL_47108.1,  9 NTs, cWW-L-R-L-tHH-L-cWW                     , Ed  5, 2, MLPS -10.64, deficit  4.38, prct   0.00; IL_76758.2,  9 NTs, cWW-L-R-L-cWW-L-L                       , Ed  4, 2, MLPS -10.77, deficit  6.11, prct   0.00; IL_25573.1,  8 NTs, cWW-tSW-L-cWW-L-L                       , Ed  4, 2, MLPS -11.15, deficit  7.54, prct   0.00; IL_21200.1, 10 NTs, cWW-tSH-tHW-L-cWW-L                     , Ed  4, 2, MLPS -11.67, deficit  5.35, prct   0.00; 
Group  88 is from IL_21001.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21001.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-R-tHW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CGAAG*UUUUUG (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_21001.1  8P9A C 3084 G 3059'

 matches the original group, cWW-L-R-tHW-L-cWW
Better:   0 Equal:   0 Score 1.00         CGAAG*UUUUUG (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_21001.1  8CRE C 3056 G 3031'

 matches the original group, cWW-L-R-tHW-L-cWW
Better:   1 Equal:   0 Score 0.00          CGAAU*AUUAG (   1) MLPS  -7.73 deficit   1.99 prct   0.00 CutScore  87.64;  Ed  0, 0
ans =

    ' IL_21001.1  5V1K C  103 G  210'

 scores better against   1 groups: IL_38507.2,  9 NTs, cWW-tWH-L-tHS-cWW                       , Ed  2, 0, MLPS -7.13, deficit  2.04, prct   0.00; 
Group 292 is from IL_70627.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70627.3
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-tHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         AGAGCC*GUAAU (   1) MLPS  -6.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70627.3  6VMY A  297 U  283'

 matches the original group, cWW-L-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00         GGAGUC*GUGAC (   1) MLPS  -6.87 deficit   0.14 prct   0.00 CutScore  99.13;  Ed  0, 0
ans =

    ' IL_70627.3  4GXY G  148 C   80'

 matches the original group, cWW-L-R-tHW-cWW
Better:   0 Equal:   0 Score 1.00        CGAAAUG*CUAAG (   1) MLPS  -9.36 deficit   2.62 prct   0.00 CutScore  83.94;  Ed  0, 0
ans =

    ' IL_70627.3  4V9F C 1483 G 1460'

 matches the original group, cWW-L-R-tHW-cWW
Group 409 is from IL_99498.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_99498.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-R-tHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GCAUG*CUUACC (   1) MLPS  -8.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_99498.1  3IGI G   10 C  262'

 matches the original group, cWW-L-R-tHW-cWW
Group 360 is from IL_85879.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85879.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-L-R-tHW-tHW-L-R-L-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  GGAUAAUGGC*GACGAUAC (   1) MLPS -10.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85879.1  8CRE G  513 C  571'

 matches the original group, cWW-L-R-tHW-tHW-L-R-L-R-cWW-cWW
Group  73 is from IL_17948.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_17948.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-R-tSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CCAAG*CGACG (   1) MLPS  -6.42 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_17948.2  5J7L C 2466 G 2484'

 matches the original group, cWW-L-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CCAAG*CGACG (   1) MLPS  -6.42 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_17948.2  4WF9 C 2493 G 2511'

 matches the original group, cWW-L-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GCAAG*CGACC (   1) MLPS  -6.46 deficit   0.04 prct   0.00 CutScore  99.64;  Ed  0, 0
ans =

    ' IL_17948.2  4V9F G 2501 C 2519'

 matches the original group, cWW-L-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GCAAG*CGACC (   1) MLPS  -6.46 deficit   0.04 prct   0.00 CutScore  99.64;  Ed  0, 0
ans =

    ' IL_17948.2  5J7L G 1272 C 1263'

 matches the original group, cWW-L-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAAG*CGACA (   1) MLPS  -6.51 deficit   0.09 prct   0.00 CutScore  99.24;  Ed  0, 0
ans =

    ' IL_17948.2  8P9A U 2835 A 2853'

 matches the original group, cWW-L-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAAG*CGACA (   1) MLPS  -6.51 deficit   0.09 prct   0.00 CutScore  99.24;  Ed  0, 0
ans =

    ' IL_17948.2  8CRE U 2807 A 2825'

 matches the original group, cWW-L-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GCAAG*CAACC (   1) MLPS  -6.82 deficit   0.40 prct   0.00 CutScore  96.61;  Ed  0, 0
ans =

    ' IL_17948.2  5J7L G  875 C  902'

 matches the original group, cWW-L-R-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCGAG*CGACA (   1) MLPS  -7.03 deficit   0.61 prct   0.00 CutScore  94.89;  Ed  0, 0
ans =

    ' IL_17948.2  4WFL U   72 A   95'

 matches the original group, cWW-L-R-tSH-tHS-cWW
Better:   1 Equal:   0 Score 0.00          CCGAG*CGGCG (   1) MLPS  -7.25 deficit   0.83 prct   0.00 CutScore  93.04;  Ed  0, 0
ans =

    ' IL_17948.2  7A0S C 2445 G 2463'

 scores better against   1 groups: IL_96788.1, 10 NTs, cWW-tHW-tHS-cWW-cWW                     , Ed  8, 4, MLPS -6.40, deficit  2.06, prct   0.00; 
Better:   1 Equal:   0 Score 0.00          CCGAG*CGGCG (   1) MLPS  -7.25 deficit   0.83 prct   0.00 CutScore  93.04;  Ed  0, 0
ans =

    ' IL_17948.2  9DFE C 2466 G 2484'

 scores better against   1 groups: IL_96788.1, 10 NTs, cWW-tHW-tHS-cWW-cWW                     , Ed  8, 4, MLPS -6.40, deficit  2.06, prct   0.00; 
Better:   0 Equal:   0 Score 1.00          GCAAC*GAAAC (   1) MLPS  -8.73 deficit   2.31 prct   0.00 CutScore  80.61;  Ed  0, 0
ans =

    ' IL_17948.2  1U6B G   84 C   60'

 matches the original group, cWW-L-R-tSH-tHS-cWW
Better:   1 Equal:   0 Score 0.00          CUCAG*CAAGG (   1) MLPS -10.49 deficit   4.07 prct   0.00 CutScore  65.91;  Ed  0, 0
ans =

    ' IL_17948.2  7A0S C 1529 G 1495'

 scores better against   1 groups: IL_58103.11, 10 NTs, cWW-cSH-cWS-L-tSW-R-R-cWW               , Ed  6, 2, MLPS -10.32, deficit  7.55, prct   0.00; 
Better:   3 Equal:   0 Score 0.00         ACUUC*GUUUGU (   1) MLPS -18.27 deficit  11.85 prct   0.00 CutScore   0.70;  Ed  0, 0
ans =

    ' IL_17948.2  6ZDP A 1298 U 1318'

 scores better against   3 groups: IL_99498.1,  8 NTs, cWW-L-R-tHW-cWW                         , Ed  7, 3, MLPS -12.85, deficit  4.70, prct   0.00; IL_29223.1, 11 NTs, cWW-L-R-L-cWW-cWW-cWW                   , Ed  5, 4, MLPS -14.18, deficit  7.91, prct   0.00; IL_82292.1, 12 NTs, cWW-L-R-L-R-L-R-L-R-cWW                 , Ed  6, 2, MLPS -15.83, deficit  5.63, prct   0.00; 
Group 352 is from IL_84694.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_84694.2
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-L-R-tSH-tHW-tHH-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   CUGAACUU*AUCAAUAAG (   1) MLPS  -9.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_84694.2  8CRE C   30 G   52'

 matches the original group, cWW-L-R-tSH-tHW-tHH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00   CUGAACUU*AUCAAUAAG (   1) MLPS  -9.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_84694.2  8P9A C   31 G   53'

 matches the original group, cWW-L-R-tSH-tHW-tHH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00   GAGAACUG*CUUAGUACC (   1) MLPS -11.60 deficit   1.76 prct   0.00 CutScore  91.86;  Ed  0, 0
ans =

    ' IL_84694.2  4WF9 G  190 C  212'

 matches the original group, cWW-L-R-tSH-tHW-tHH-tHS-cWW-cWW
Group  14 is from IL_04021.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_04021.2
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-tSH-tSH-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GUGGAUG*CUGAAAC (   1) MLPS  -6.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04021.2  4WF9 G   24 C  561'

 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      GUGGAUG*CUGAAAC (   1) MLPS  -6.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04021.2  5J7L G   24 C  516'

 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      GUGGAUG*CUGAAAC (   1) MLPS  -6.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04021.2  7A0S G   24 C  526'

 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      GUGGAUG*CUGAAAC (   1) MLPS  -6.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04021.2  9DFE G   24 C  516'

 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      GUGGAUU*AUGAAAU (   1) MLPS  -7.34 deficit   1.18 prct   0.00 CutScore  94.11;  Ed  0, 0
ans =

    ' IL_04021.2  4V9F G   21 U  522'

 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      ACGGAUC*GUGAAAU (   1) MLPS  -7.53 deficit   1.37 prct   0.00 CutScore  93.13;  Ed  0, 0
ans =

    ' IL_04021.2  8CRE A   13 U  410'

 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      ACGGAUC*GUGAAAU (   1) MLPS  -7.53 deficit   1.37 prct   0.00 CutScore  93.13;  Ed  0, 0
ans =

    ' IL_04021.2  8P9A A   13 U  410'

 matches the original group, cWW-L-R-tSH-tSH-tHS-cWW-cWW
Group 264 is from IL_65594.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_65594.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-L-R-tSW-tHH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CUCAGUAG*UGAAGCG (   1) MLPS  -8.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65594.1  8CRE C   81 G  102'

 matches the original group, cWW-L-R-tSW-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUUAGUAA*UGAAGCG (   1) MLPS  -8.65 deficit   0.39 prct   0.00 CutScore  98.05;  Ed  0, 0
ans =

    ' IL_65594.1  8P9A C   82 G  103'

 matches the original group, cWW-L-R-tSW-tHH-cSH-tWH-tHS-cWW
Group  98 is from IL_23038.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_23038.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-tWH-L-R-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UCUUAUG*UUAUCA (   1) MLPS  -5.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_23038.1  8P9A U 1737 A 1707'

 matches the original group, cWW-L-R-tWH-L-R-L-cWW-cWW
Better:   0 Equal:   0 Score 1.00       UCUUAUG*UUAUCA (   1) MLPS  -5.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_23038.1  8CRE U 1733 A 1703'

 matches the original group, cWW-L-R-tWH-L-R-L-cWW-cWW
Group  38 is from IL_09129.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09129.2
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-tWH-L-R-L-tWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UACAAAG*CAAAAAG (   1) MLPS  -7.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09129.2  4LFB U 1247 G 1290'

 matches the original group, cWW-L-R-tWH-L-R-L-tWW-cWW
Better:   0 Equal:   0 Score 1.00      UACAAAG*CAUAAAG (   1) MLPS  -7.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09129.2  5J7L U 1247 G 1290'

 matches the original group, cWW-L-R-tWH-L-R-L-tWW-cWW
Group 133 is from IL_31561.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31561.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-R-tWH-tWH-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GACUGAC*GAAACC (   1) MLPS  -5.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31561.1  4LFB G  477 C  455'

 matches the original group, cWW-L-R-tWH-tWH-L-R-L-cWW
Group 234 is from IL_58350.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_58350.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-R-tWH-tWH-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     GGACAAAG*UUAAAUC (   1) MLPS  -8.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_58350.1  2NZ4 G  119 C  102'

 matches the original group, cWW-L-R-tWH-tWH-L-R-L-cWW-L
Group 145 is from IL_34737.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_34737.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-cHW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CGUAUC*GAAG (   1) MLPS  -6.46 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_34737.1  8CRE C  973 G 1100'

 matches the original group, cWW-L-cHW-L-cWW-L
Group 308 is from IL_74957.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_74957.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-cHW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UAAUAAGC*GUA (   1) MLPS  -7.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_74957.1  2R8S U  182 A  136'

 matches the original group, cWW-L-cHW-L-cWW-L
Group 329 is from IL_80398.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80398.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-cSW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GAAA*UAAC (   1) MLPS  -5.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80398.1  4TS2 G   14 C   85'

 matches the original group, cWW-L-cSW-L-R-cWW
Group 351 is from IL_84665.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_84665.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-L-cSW-cWW-L-L-R-L-R-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CCACAGCAGAAG*CAG (   1) MLPS -10.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_84665.1  7QR4 C    6 G   31'

 matches the original group, cWW-L-cSW-cWW-L-L-R-L-R-L-R-L
Group   1 is from IL_00225.13 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_00225.13
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               UGC*GG (   1) MLPS  -3.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00225.13  8VFS U    5 G   23'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GG (   1) MLPS  -3.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00225.13  4V9F U  374 G  275'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GG (   1) MLPS  -3.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00225.13  3DIL U  109 G   85'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GG (   1) MLPS  -3.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00225.13  6JQ5 U   62 G   32'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GG (   1) MLPS  -3.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00225.13  1U9S U  158 G  141'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GG (   1) MLPS  -3.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00225.13  7A0S U 2853 G 2814'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GG (   1) MLPS  -3.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00225.13  6JQ5 U   62 G   32'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GG (   1) MLPS  -3.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00225.13  5J7L U   93 G   76'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CGC*GG (   1) MLPS  -3.22 deficit   0.05 prct   0.00 CutScore  99.45;  Ed  0, 0
ans =

    ' IL_00225.13  7D7W C   37 G   23'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CGC*GG (   1) MLPS  -3.22 deficit   0.05 prct   0.00 CutScore  99.45;  Ed  0, 0
ans =

    ' IL_00225.13  4WF9 C 2229 G 2248'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CGC*GG (   1) MLPS  -3.22 deficit   0.05 prct   0.00 CutScore  99.45;  Ed  0, 0
ans =

    ' IL_00225.13  3NDB C  239 G  138'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CGC*GG (   1) MLPS  -3.22 deficit   0.05 prct   0.00 CutScore  99.45;  Ed  0, 0
ans =

    ' IL_00225.13  8ZA0 C    5 G   11'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CGC*GG (   1) MLPS  -3.22 deficit   0.05 prct   0.00 CutScore  99.45;  Ed  0, 0
ans =

    ' IL_00225.13  2IZN C    5 G   15'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CGC*GG (   1) MLPS  -3.22 deficit   0.05 prct   0.00 CutScore  99.45;  Ed  0, 0
ans =

    ' IL_00225.13  9FN3 C   29 G   16'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GA (   1) MLPS  -3.26 deficit   0.09 prct   0.00 CutScore  99.04;  Ed  0, 0
ans =

    ' IL_00225.13  8TSV U    6 A   20'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GA (   1) MLPS  -3.26 deficit   0.09 prct   0.00 CutScore  99.04;  Ed  0, 0
ans =

    ' IL_00225.13  8CRE U 1070 A 1080'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GA (   1) MLPS  -3.26 deficit   0.09 prct   0.00 CutScore  99.04;  Ed  0, 0
ans =

    ' IL_00225.13  8TSV U    6 A   20'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGC*GA (   1) MLPS  -3.26 deficit   0.09 prct   0.00 CutScore  99.04;  Ed  0, 0
ans =

    ' IL_00225.13  5J7L U  913 A  863'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGA*UG (   1) MLPS  -3.39 deficit   0.22 prct   0.00 CutScore  97.66;  Ed  0, 0
ans =

    ' IL_00225.13  7D7V U   44 G   22'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGA*UG (   1) MLPS  -3.39 deficit   0.22 prct   0.00 CutScore  97.66;  Ed  0, 0
ans =

    ' IL_00225.13  5J7L U  387 G  376'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGA*UG (   1) MLPS  -3.39 deficit   0.22 prct   0.00 CutScore  97.66;  Ed  0, 0
ans =

    ' IL_00225.13  4LFB U  387 G  376'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGC*GU (   1) MLPS  -3.43 deficit   0.25 prct   0.00 CutScore  97.33;  Ed  0, 0
ans =

    ' IL_00225.13  8CRE G  855 U  830'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGC*GU (   1) MLPS  -3.43 deficit   0.25 prct   0.00 CutScore  97.33;  Ed  0, 0
ans =

    ' IL_00225.13  9DFE G  728 U  703'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGC*GU (   1) MLPS  -3.43 deficit   0.25 prct   0.00 CutScore  97.33;  Ed  0, 0
ans =

    ' IL_00225.13  8P9A G  859 U  834'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00               CGA*UG (   1) MLPS  -3.45 deficit   0.27 prct   0.00 CutScore  97.11;  Ed  0, 0
ans =

    ' IL_00225.13  6TFF C   37 G   23'

 scores better against   1 groups: IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.34, deficit  0.21, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               UGA*UA (   1) MLPS  -3.49 deficit   0.31 prct   0.00 CutScore  96.70;  Ed  0, 0
ans =

    ' IL_00225.13  5J7L U   30 A  553'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGA*UA (   1) MLPS  -3.49 deficit   0.31 prct   0.00 CutScore  96.70;  Ed  0, 0
ans =

    ' IL_00225.13  4LFB U   30 A  553'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGA*UU (   1) MLPS  -3.65 deficit   0.48 prct   0.00 CutScore  95.00;  Ed  0, 0
ans =

    ' IL_00225.13  8CRE G 1134 U 1615'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGA*UU (   1) MLPS  -3.65 deficit   0.48 prct   0.00 CutScore  95.00;  Ed  0, 0
ans =

    ' IL_00225.13  8P9A G 1149 U 1628'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGA*UU (   1) MLPS  -3.65 deficit   0.48 prct   0.00 CutScore  95.00;  Ed  0, 0
ans =

    ' IL_00225.13  4WF9 G  773 U  748'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGA*UU (   1) MLPS  -3.65 deficit   0.48 prct   0.00 CutScore  95.00;  Ed  0, 0
ans =

    ' IL_00225.13  7A0S G  741 U  716'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGA*UU (   1) MLPS  -3.65 deficit   0.48 prct   0.00 CutScore  95.00;  Ed  0, 0
ans =

    ' IL_00225.13  5J7L G  728 U  703'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00               UGG*CG (   1) MLPS  -3.68 deficit   0.51 prct   0.00 CutScore  94.60;  Ed  0, 0
ans =

    ' IL_00225.13  4V9F U 1136 G 1226'

 scores better against   1 groups: IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.16, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UGG*CG (   1) MLPS  -3.68 deficit   0.51 prct   0.00 CutScore  94.60;  Ed  0, 0
ans =

    ' IL_00225.13  3D0U U  106 G   82'

 scores better against   1 groups: IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.16, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CGU*AG (   1) MLPS  -3.69 deficit   0.52 prct   0.00 CutScore  94.52;  Ed  0, 0
ans =

    ' IL_00225.13  8I3Z C   10 G   54'

 scores better against   1 groups: IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.35, deficit  0.22, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UGU*AA (   1) MLPS  -3.73 deficit   0.56 prct   0.00 CutScore  94.12;  Ed  0, 0
ans =

    ' IL_00225.13  3IGI U   82 A  100'

 scores better against   1 groups: IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.56, deficit  0.43, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UGU*AA (   1) MLPS  -3.73 deficit   0.56 prct   0.00 CutScore  94.12;  Ed  0, 0
ans =

    ' IL_00225.13  4C7O U   27 A   16'

 scores better against   1 groups: IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.56, deficit  0.43, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CGG*CG (   1) MLPS  -3.74 deficit   0.57 prct   0.00 CutScore  94.05;  Ed  0, 0
ans =

    ' IL_00225.13  5DEA C    5 G   31'

 scores better against   1 groups: IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.13, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CGG*CG (   1) MLPS  -3.74 deficit   0.57 prct   0.00 CutScore  94.05;  Ed  0, 0
ans =

    ' IL_00225.13  5DE8 C    5 G   31'

 scores better against   1 groups: IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.13, deficit  0.00, prct   0.00; 
Better:   3 Equal:   0 Score 0.00               GGA*UC (   1) MLPS  -3.76 deficit   0.59 prct   0.00 CutScore  93.82;  Ed  0, 0
ans =

    ' IL_00225.13  8P9A G  458 C  448'

 scores better against   3 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.40, deficit  0.23, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.54, deficit  0.41, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -3.65, deficit  0.10, prct   0.00; 
Better:   3 Equal:   0 Score 0.00               GGA*UC (   1) MLPS  -3.76 deficit   0.59 prct   0.00 CutScore  93.82;  Ed  0, 0
ans =

    ' IL_00225.13  8CRE G  456 C  446'

 scores better against   3 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.40, deficit  0.23, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.54, deficit  0.41, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -3.65, deficit  0.10, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               AGU*AU (   1) MLPS  -3.96 deficit   0.78 prct   0.00 CutScore  91.75;  Ed  0, 0
ans =

    ' IL_00225.13  8P9A A  983 U 1100'

 scores better against   1 groups: IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.58, deficit  0.44, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               AGU*AU (   1) MLPS  -3.96 deficit   0.78 prct   0.00 CutScore  91.75;  Ed  0, 0
ans =

    ' IL_00225.13  8CRE A  979 U 1096'

 scores better against   1 groups: IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.58, deficit  0.44, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               AGU*AU (   1) MLPS  -3.96 deficit   0.78 prct   0.00 CutScore  91.75;  Ed  0, 0
ans =

    ' IL_00225.13  4V9F A  819 U  794'

 scores better against   1 groups: IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.58, deficit  0.44, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               AGG*CU (   1) MLPS  -4.00 deficit   0.83 prct   0.00 CutScore  91.28;  Ed  0, 0
ans =

    ' IL_00225.13  5U30 A    7 U    4'

 scores better against   2 groups: IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.35, deficit  0.22, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -3.96, deficit  0.41, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               GGG*UU (   1) MLPS  -5.26 deficit   2.09 prct   0.00 CutScore  78.04;  Ed  0, 0
ans =

    ' IL_00225.13  4LFB G  925 U 1391'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGG*UU (   1) MLPS  -5.26 deficit   2.09 prct   0.00 CutScore  78.04;  Ed  0, 0
ans =

    ' IL_00225.13  5J7L G  925 U 1391'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGU*GC (   1) MLPS  -5.42 deficit   2.25 prct   0.00 CutScore  76.35;  Ed  0, 0
ans =

    ' IL_00225.13  4LVW G   67 C   18'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GGU*GC (   1) MLPS  -5.42 deficit   2.25 prct   0.00 CutScore  76.35;  Ed  0, 0
ans =

    ' IL_00225.13  3SUX G   76 C   21'

 matches the original group, cWW-L-cWW
Group  11 is from IL_02555.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_02555.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CAAG*UG (   1) MLPS  -2.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_02555.1  5J7L C 2540 G 2523'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              CAAG*UG (   1) MLPS  -2.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_02555.1  4WF9 C 2567 G 2550'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              CAAG*UG (   1) MLPS  -2.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_02555.1  7A0S C 2519 G 2502'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              CAAG*UG (   1) MLPS  -2.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_02555.1  9DFE C 2540 G 2523'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              CAAG*UG (   1) MLPS  -2.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_02555.1  4V9F C 2575 G 2558'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              UAAG*UA (   1) MLPS  -2.52 deficit   0.22 prct   0.00 CutScore  97.75;  Ed  0, 0
ans =

    ' IL_02555.1  8P9A U 2909 A 2892'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              UAAG*UA (   1) MLPS  -2.52 deficit   0.22 prct   0.00 CutScore  97.75;  Ed  0, 0
ans =

    ' IL_02555.1  8CRE U 2881 A 2864'

 matches the original group, cWW-L-cWW
Better:   9 Equal:   0 Score 0.00              CUAG*CG (   1) MLPS  -5.91 deficit   3.61 prct   0.00 CutScore  62.29;  Ed  0, 0
ans =

    ' IL_02555.1  8DP3 C   48 G   79'

 scores better against   9 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.60, deficit  1.34, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.72, deficit  0.56, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.56, deficit  0.75, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -5.57, deficit  0.00, prct   0.00; IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -5.58, deficit  1.64, prct   0.00; 
Better:  12 Equal:   0 Score 0.00              CAAG*CG (   1) MLPS  -5.97 deficit   3.67 prct   0.00 CutScore  61.69;  Ed  0, 0
ans =

    ' IL_02555.1  4KQY C   73 G   50'

 scores better against  12 groups: IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.05, deficit  0.12, prct   0.00; IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -4.13, deficit  0.86, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  3, 0, MLPS -4.62, deficit  0.54, prct   0.00; IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  4, 1, MLPS -4.70, deficit  1.84, prct   0.00; IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  1, 0, MLPS -4.85, deficit  0.36, prct   0.00; 
Group  31 is from IL_07039.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_07039.3
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               UGG*CG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07039.3  4V9F U 2615 G 2543'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGG*CG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07039.3  8P9A U 2949 G 2877'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGG*CG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07039.3  8CRE U 2921 G 2849'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGG*CG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07039.3  4WF9 U 2607 G 2535'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGG*CG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07039.3  9DFE U 2580 G 2508'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGG*CG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07039.3  7A0S U 2559 G 2487'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UGG*CG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07039.3  5J7L U 2580 G 2508'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00               UGA*UG (   1) MLPS  -3.41 deficit   0.25 prct   0.00 CutScore  97.94;  Ed  0, 0
ans =

    ' IL_07039.3  5J7L U 2457 G 2494'

 scores better against   1 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.39, deficit  0.22, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               UAU*AG (   1) MLPS  -3.69 deficit   0.53 prct   0.00 CutScore  95.61;  Ed  0, 0
ans =

    ' IL_07039.3  5XTM U    3 G   45'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAU*AG (   1) MLPS  -3.69 deficit   0.53 prct   0.00 CutScore  95.61;  Ed  0, 0
ans =

    ' IL_07039.3  5DCV U    3 G   49'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAU*AG (   1) MLPS  -3.69 deficit   0.53 prct   0.00 CutScore  95.61;  Ed  0, 0
ans =

    ' IL_07039.3  1U6B U  160 G  151'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAU*AG (   1) MLPS  -3.69 deficit   0.53 prct   0.00 CutScore  95.61;  Ed  0, 0
ans =

    ' IL_07039.3  5VCI U    2 G   12'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAU*AG (   1) MLPS  -3.69 deficit   0.53 prct   0.00 CutScore  95.61;  Ed  0, 0
ans =

    ' IL_07039.3  4PCJ U   25 G   12'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUG*UG (   1) MLPS  -5.15 deficit   1.99 prct   0.00 CutScore  83.58;  Ed  0, 0
ans =

    ' IL_07039.3  8CRE U 2798 G 2835'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUG*UG (   1) MLPS  -5.15 deficit   1.99 prct   0.00 CutScore  83.58;  Ed  0, 0
ans =

    ' IL_07039.3  8P9A U 2826 G 2863'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UCG*UG (   1) MLPS  -5.66 deficit   2.50 prct   0.00 CutScore  79.36;  Ed  0, 0
ans =

    ' IL_07039.3  4V9F U 2492 G 2529'

 matches the original group, cWW-L-cWW
Group  46 is from IL_10569.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_10569.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   4 Equal:   0 Score 0.00               CAG*CG (   1) MLPS  -3.55 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10569.1  4V84 C 6181 G 6195'

 scores better against   4 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.62, deficit  0.35, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.03, deficit  0.29, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.39, deficit -0.04, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.48, deficit  0.26, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               AAA*UU (   1) MLPS  -3.84 deficit   0.28 prct   0.00 CutScore  97.02;  Ed  0, 0
ans =

    ' IL_10569.1  1HYS A  867 U  887'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.44, deficit  0.27, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.80, deficit  0.37, prct   0.00; 
Group  67 is from IL_16386.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_16386.4
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               CGG*CG (   1) MLPS  -3.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_16386.4  8GXB C   40 G    6'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CGG*CG (   1) MLPS  -3.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_16386.4  8HBA C   32 G    6'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CGG*CG (   1) MLPS  -3.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_16386.4  8I3Z C   32 G    6'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CGG*CG (   1) MLPS  -3.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_16386.4  8GXB C   40 G    6'

 matches the original group, cWW-L-cWW
Group 113 is from IL_26793.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_26793.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   2 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26793.1  7ZO1 G    5 C   15'

 scores better against   2 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.22, deficit  0.00, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26793.1  5J7L G 1041 C  999'

 scores better against   2 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.22, deficit  0.00, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26793.1  9DFE G 1448 C 1463'

 scores better against   2 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.22, deficit  0.00, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               AAG*CU (   1) MLPS  -3.44 deficit   0.00 prct   0.00 CutScore  99.95;  Ed  0, 0
ans =

    ' IL_26793.1  7A0S A 1463 U 1478'

 scores better against   2 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.06, deficit  0.79, prct   0.00; IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -3.36, deficit  0.19, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               AAG*CU (   1) MLPS  -3.44 deficit   0.00 prct   0.00 CutScore  99.95;  Ed  0, 0
ans =

    ' IL_26793.1  5J7L A  746 U  659'

 scores better against   2 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.06, deficit  0.79, prct   0.00; IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -3.36, deficit  0.19, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               AAG*CU (   1) MLPS  -3.44 deficit   0.00 prct   0.00 CutScore  99.95;  Ed  0, 0
ans =

    ' IL_26793.1  5VSU A   75 U   70'

 scores better against   2 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.06, deficit  0.79, prct   0.00; IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -3.36, deficit  0.19, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAG*CA (   1) MLPS  -3.48 deficit   0.05 prct   0.00 CutScore  99.50;  Ed  0, 0
ans =

    ' IL_26793.1  4V9F U 2436 A 2455'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.95, deficit  0.69, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAG*CA (   1) MLPS  -3.48 deficit   0.05 prct   0.00 CutScore  99.50;  Ed  0, 0
ans =

    ' IL_26793.1  8CRE U 1107 A  966'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.95, deficit  0.69, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAG*CA (   1) MLPS  -3.48 deficit   0.05 prct   0.00 CutScore  99.50;  Ed  0, 0
ans =

    ' IL_26793.1  8P9A U 1111 A  970'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.95, deficit  0.69, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               GAA*UC (   1) MLPS  -3.79 deficit   0.36 prct   0.00 CutScore  96.17;  Ed  0, 0
ans =

    ' IL_26793.1  5J7L G  926 C  851'

 scores better against   2 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.28, deficit  1.01, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.57, deficit  0.34, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CCU*AG (   1) MLPS  -4.23 deficit   0.80 prct   0.00 CutScore  91.62;  Ed  0, 0
ans =

    ' IL_26793.1  9DFE C 2498 G 2454'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.26, deficit  0.10, prct   0.00; IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.27, deficit  0.73, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CCU*AG (   1) MLPS  -4.23 deficit   0.80 prct   0.00 CutScore  91.62;  Ed  0, 0
ans =

    ' IL_26793.1  7A0S C 2477 G 2433'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.26, deficit  0.10, prct   0.00; IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.27, deficit  0.73, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CCU*AG (   1) MLPS  -4.23 deficit   0.80 prct   0.00 CutScore  91.62;  Ed  0, 0
ans =

    ' IL_26793.1  4WF9 C 2525 G 2481'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.26, deficit  0.10, prct   0.00; IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.27, deficit  0.73, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CCU*AG (   1) MLPS  -4.23 deficit   0.80 prct   0.00 CutScore  91.62;  Ed  0, 0
ans =

    ' IL_26793.1  5J7L C 2498 G 2454'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.26, deficit  0.10, prct   0.00; IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.27, deficit  0.73, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               ACU*AU (   1) MLPS  -4.27 deficit   0.84 prct   0.00 CutScore  91.14;  Ed  0, 0
ans =

    ' IL_26793.1  7KGA A   37 U   16'

 scores better against   1 groups: IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.36, deficit  0.82, prct   0.00; 
Better:   7 Equal:   0 Score 0.00               CUG*CG (   1) MLPS  -5.34 deficit   1.91 prct   0.00 CutScore  79.95;  Ed  0, 0
ans =

    ' IL_26793.1  8CRE C 2182 G 2216'

 scores better against   7 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.20, deficit  1.05, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.84, deficit  0.62, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.96, deficit  1.22, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  1, 1, MLPS -4.70, deficit  0.19, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -4.87, deficit  0.06, prct   0.00; 
Group 129 is from IL_31462.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31462.6
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  5AOX G   56 C  109'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  1EFO G   15 C    4'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  6XH2 G   34 C   30'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  4AOB G   13 C   41'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE G  775 C  749'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A G  779 C  753'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  2C4Q G    5 C   15'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  3V7E G   13 C   41'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  9DFE G  763 C  698'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  6CYT G   34 C   30'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  7A0S G  776 C  711'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  6D3P G   27 C   13'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  1MFQ G  175 C  221'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  9DFE G 1459 C 1451'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  5FJC G   13 C   41'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE G  505 C  579'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  4PHY G   38 C   13'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  5CNR G   38 C   13'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CC (   1) MLPS  -2.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31462.6  4P97 G   38 C   13'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  1DUQ G  120 C  109'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  1CSL G   67 C   51'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  9DFE G 1219 C 1230'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  5J7L G  442 C   37'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  9DFE G  442 C   37'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  4WF9 G  488 C   37'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  9DFE G 1980 C 1771'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  1U9S G  107 C   96'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  1NBS G  129 C  114'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  7A0S G  454 C   37'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  4V9F G  448 C   34'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  9C75 G   30 C   14'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  7A0S G  600 C  679'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  5J7L G  763 C  698'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  8UO6 G   60 C   43'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  8X5V G   61 C   56'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GC (   1) MLPS  -2.61 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_31462.6  8XZL G   32 C   28'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE C  575 G  509'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  4R4V C  651 G  767'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  3B31 C 6181 G 6195'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  5J7L C 2601 G 2592'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE C 2942 G 2933'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  4V9F C 2021 G 1827'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A C 2970 G 2961'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  4WF9 C  175 G  153'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  2QUX C    5 G   21'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE C 1412 G 1266'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A C 1426 G 1281'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  4LGT C 2601 G 2592'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  5J7L C 1489 G 1500'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE C 1381 G 1417'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A C 1385 G 1421'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  9DFE C 2601 G 2592'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  2NZ4 C    5 G   53'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  4WF9 C 2628 G 2619'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  9DFE C   65 G   18'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CAG*CG (   1) MLPS  -2.62 deficit   0.35 prct   0.00 CutScore  96.33;  Ed  0, 0
ans =

    ' IL_31462.6  4V9F C   64 G   16'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CA (   1) MLPS  -2.95 deficit   0.69 prct   0.00 CutScore  92.78;  Ed  0, 0
ans =

    ' IL_31462.6  4R4V U  712 A  661'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CA (   1) MLPS  -2.95 deficit   0.69 prct   0.00 CutScore  92.78;  Ed  0, 0
ans =

    ' IL_31462.6  7KGA U   39 A   15'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CA (   1) MLPS  -2.95 deficit   0.69 prct   0.00 CutScore  92.78;  Ed  0, 0
ans =

    ' IL_31462.6  7KGA U   39 A   15'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CA (   1) MLPS  -2.95 deficit   0.69 prct   0.00 CutScore  92.78;  Ed  0, 0
ans =

    ' IL_31462.6  4WF9 U   63 A   16'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00               CAC*GG (   1) MLPS  -2.96 deficit   0.70 prct   0.00 CutScore  92.67;  Ed  0, 0
ans =

    ' IL_31462.6  6MSF C    2 G   13'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -2.74, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CAC*GG (   1) MLPS  -2.96 deficit   0.70 prct   0.00 CutScore  92.67;  Ed  0, 0
ans =

    ' IL_31462.6  4V9F C 2895 G 2861'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -2.74, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CAC*GG (   1) MLPS  -2.96 deficit   0.70 prct   0.00 CutScore  92.67;  Ed  0, 0
ans =

    ' IL_31462.6  4PHY C   20 G   31'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -2.74, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CAC*GG (   1) MLPS  -2.96 deficit   0.70 prct   0.00 CutScore  92.67;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A C 2625 G 2615'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -2.74, deficit  0.00, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               AAG*CU (   1) MLPS  -3.06 deficit   0.79 prct   0.00 CutScore  91.71;  Ed  0, 0
ans =

    ' IL_31462.6  8VFS A   11 U   18'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AAG*CU (   1) MLPS  -3.06 deficit   0.79 prct   0.00 CutScore  91.71;  Ed  0, 0
ans =

    ' IL_31462.6  9DE7 A   15 U   46'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AAG*CU (   1) MLPS  -3.06 deficit   0.79 prct   0.00 CutScore  91.71;  Ed  0, 0
ans =

    ' IL_31462.6  4P3U A   17 U   31'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AAG*CU (   1) MLPS  -3.06 deficit   0.79 prct   0.00 CutScore  91.71;  Ed  0, 0
ans =

    ' IL_31462.6  4P3U A   17 U   31'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AAG*CU (   1) MLPS  -3.06 deficit   0.79 prct   0.00 CutScore  91.71;  Ed  0, 0
ans =

    ' IL_31462.6  4P3U A   40 U    8'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AAG*CU (   1) MLPS  -3.06 deficit   0.79 prct   0.00 CutScore  91.71;  Ed  0, 0
ans =

    ' IL_31462.6  4P3U A   40 U    8'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AAG*CU (   1) MLPS  -3.06 deficit   0.79 prct   0.00 CutScore  91.71;  Ed  0, 0
ans =

    ' IL_31462.6  8OI5 A   63 U   16'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AAG*CU (   1) MLPS  -3.06 deficit   0.79 prct   0.00 CutScore  91.71;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A A   63 U   16'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAU*AC (   1) MLPS  -3.10 deficit   0.83 prct   0.00 CutScore  91.28;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE G 3147 C 3176'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAU*AC (   1) MLPS  -3.10 deficit   0.83 prct   0.00 CutScore  91.28;  Ed  0, 0
ans =

    ' IL_31462.6  5WWT G   37 C   32'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAU*AC (   1) MLPS  -3.10 deficit   0.83 prct   0.00 CutScore  91.28;  Ed  0, 0
ans =

    ' IL_31462.6  7MKY G   49 C   36'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAU*AC (   1) MLPS  -3.10 deficit   0.83 prct   0.00 CutScore  91.28;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A G 3177 C 3211'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAU*AC (   1) MLPS  -3.10 deficit   0.83 prct   0.00 CutScore  91.28;  Ed  0, 0
ans =

    ' IL_31462.6  4V9F G  856 C  789'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAU*AC (   1) MLPS  -3.10 deficit   0.83 prct   0.00 CutScore  91.28;  Ed  0, 0
ans =

    ' IL_31462.6  8UIW G   44 C   64'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAA*UC (   1) MLPS  -3.28 deficit   1.01 prct   0.00 CutScore  89.36;  Ed  0, 0
ans =

    ' IL_31462.6  2VPL G   28 C   17'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAA*UC (   1) MLPS  -3.28 deficit   1.01 prct   0.00 CutScore  89.36;  Ed  0, 0
ans =

    ' IL_31462.6  6WPI G   11 C   42'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAA*UC (   1) MLPS  -3.28 deficit   1.01 prct   0.00 CutScore  89.36;  Ed  0, 0
ans =

    ' IL_31462.6  1U63 G   28 C   17'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAA*UC (   1) MLPS  -3.28 deficit   1.01 prct   0.00 CutScore  89.36;  Ed  0, 0
ans =

    ' IL_31462.6  4WF9 G  808 C  743'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAA*UC (   1) MLPS  -3.28 deficit   1.01 prct   0.00 CutScore  89.36;  Ed  0, 0
ans =

    ' IL_31462.6  3OXE G   12 C   28'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAC*GA (   1) MLPS  -3.30 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_31462.6  5J7L U 1393 A  923'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAC*GA (   1) MLPS  -3.30 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_31462.6  4LFB U 1393 A  923'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAC*GA (   1) MLPS  -3.30 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE U 1617 A 1132'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAC*GA (   1) MLPS  -3.30 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A U 1630 A 1147'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAC*GA (   1) MLPS  -3.30 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A U 1074 A 1084'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAC*GA (   1) MLPS  -3.30 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_31462.6  1JZV U   12 A    5'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAC*GA (   1) MLPS  -3.30 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_31462.6  4V9F U 2290 A 2280'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AAC*GU (   1) MLPS  -3.40 deficit   1.13 prct   0.00 CutScore  88.05;  Ed  0, 0
ans =

    ' IL_31462.6  3CGR A   19 U    7'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CG (   1) MLPS  -3.42 deficit   1.16 prct   0.00 CutScore  87.83;  Ed  0, 0
ans =

    ' IL_31462.6  8VM9 U   43 G   76'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CG (   1) MLPS  -3.42 deficit   1.16 prct   0.00 CutScore  87.83;  Ed  0, 0
ans =

    ' IL_31462.6  8VMB U   46 G   76'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CG (   1) MLPS  -3.42 deficit   1.16 prct   0.00 CutScore  87.83;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A U 1398 G 1412'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CG (   1) MLPS  -3.42 deficit   1.16 prct   0.00 CutScore  87.83;  Ed  0, 0
ans =

    ' IL_31462.6  8VMA U   46 G   79'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CG (   1) MLPS  -3.42 deficit   1.16 prct   0.00 CutScore  87.83;  Ed  0, 0
ans =

    ' IL_31462.6  9DFE U 1489 G 1500'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CG (   1) MLPS  -3.42 deficit   1.16 prct   0.00 CutScore  87.83;  Ed  0, 0
ans =

    ' IL_31462.6  2OZB U   24 G   48'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CG (   1) MLPS  -3.42 deficit   1.16 prct   0.00 CutScore  87.83;  Ed  0, 0
ans =

    ' IL_31462.6  5J7L U 1440 G 1461'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CG (   1) MLPS  -3.42 deficit   1.16 prct   0.00 CutScore  87.83;  Ed  0, 0
ans =

    ' IL_31462.6  4V9F U  942 G 1024'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UAG*CG (   1) MLPS  -3.42 deficit   1.16 prct   0.00 CutScore  87.83;  Ed  0, 0
ans =

    ' IL_31462.6  5J7L U   65 G   18'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00               CAU*AG (   1) MLPS  -3.44 deficit   1.18 prct   0.00 CutScore  87.61;  Ed  0, 0
ans =

    ' IL_31462.6  7JJU C   31 G   13'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.03, deficit  0.29, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CAU*AG (   1) MLPS  -3.44 deficit   1.18 prct   0.00 CutScore  87.61;  Ed  0, 0
ans =

    ' IL_31462.6  7JJU C   31 G   13'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.03, deficit  0.29, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CAU*AG (   1) MLPS  -3.44 deficit   1.18 prct   0.00 CutScore  87.61;  Ed  0, 0
ans =

    ' IL_31462.6  4L8H C    4 G   17'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.03, deficit  0.29, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CAU*AG (   1) MLPS  -3.44 deficit   1.18 prct   0.00 CutScore  87.61;  Ed  0, 0
ans =

    ' IL_31462.6  5J7L C  396 G   45'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.03, deficit  0.29, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CAA*UG (   1) MLPS  -3.63 deficit   1.36 prct   0.00 CutScore  85.69;  Ed  0, 0
ans =

    ' IL_31462.6  5J7L C 1195 G 1061'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.21, deficit  0.47, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAC*GG (   1) MLPS  -3.77 deficit   1.50 prct   0.00 CutScore  84.17;  Ed  0, 0
ans =

    ' IL_31462.6  9DFE U  895 G  881'

 scores better against   1 groups: IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.68, deficit  0.35, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAC*GG (   1) MLPS  -3.77 deficit   1.50 prct   0.00 CutScore  84.17;  Ed  0, 0
ans =

    ' IL_31462.6  7DLZ U    6 G   40'

 scores better against   1 groups: IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.68, deficit  0.35, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAC*GG (   1) MLPS  -3.77 deficit   1.50 prct   0.00 CutScore  84.17;  Ed  0, 0
ans =

    ' IL_31462.6  7VTI U   31 G    5'

 scores better against   1 groups: IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.68, deficit  0.35, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAC*GG (   1) MLPS  -3.77 deficit   1.50 prct   0.00 CutScore  84.17;  Ed  0, 0
ans =

    ' IL_31462.6  7JNH U   55 G   36'

 scores better against   1 groups: IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.68, deficit  0.35, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAC*GG (   1) MLPS  -3.77 deficit   1.50 prct   0.00 CutScore  84.17;  Ed  0, 0
ans =

    ' IL_31462.6  7DLZ U    9 G   38'

 scores better against   1 groups: IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.68, deficit  0.35, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAU*AA (   1) MLPS  -3.78 deficit   1.51 prct   0.00 CutScore  84.06;  Ed  0, 0
ans =

    ' IL_31462.6  9DID U   35 A   49'

 scores better against   1 groups: IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.67, deficit  0.24, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAU*AA (   1) MLPS  -3.78 deficit   1.51 prct   0.00 CutScore  84.06;  Ed  0, 0
ans =

    ' IL_31462.6  9DID U   35 A   49'

 scores better against   1 groups: IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.67, deficit  0.24, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               AAU*AU (   1) MLPS  -3.88 deficit   1.62 prct   0.00 CutScore  82.99;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A A  265 U  289'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.45, deficit  0.29, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.63, deficit  0.19, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               AAU*AU (   1) MLPS  -3.88 deficit   1.62 prct   0.00 CutScore  82.99;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A A  505 U  482'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.45, deficit  0.29, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.63, deficit  0.19, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               AAU*AU (   1) MLPS  -3.88 deficit   1.62 prct   0.00 CutScore  82.99;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE A  891 U  825'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.45, deficit  0.29, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.63, deficit  0.19, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               AAU*AU (   1) MLPS  -3.88 deficit   1.62 prct   0.00 CutScore  82.99;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE A  503 U  480'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.45, deficit  0.29, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.63, deficit  0.19, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               UAA*UA (   1) MLPS  -3.96 deficit   1.70 prct   0.00 CutScore  82.14;  Ed  0, 0
ans =

    ' IL_31462.6  1I9X U    4 A   10'

 scores better against   2 groups: IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.84, deficit  0.41, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.90, deficit  0.34, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               UAA*UA (   1) MLPS  -3.96 deficit   1.70 prct   0.00 CutScore  82.14;  Ed  0, 0
ans =

    ' IL_31462.6  3CGP U   19 A    7'

 scores better against   2 groups: IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.84, deficit  0.41, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.90, deficit  0.34, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               UAA*UA (   1) MLPS  -3.96 deficit   1.70 prct   0.00 CutScore  82.14;  Ed  0, 0
ans =

    ' IL_31462.6  1I9X U    4 A   10'

 scores better against   2 groups: IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.84, deficit  0.41, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.90, deficit  0.34, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               GAG*CU (   1) MLPS  -4.17 deficit   1.90 prct   0.00 CutScore  79.95;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A G 2323 U 2129'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAG*CU (   1) MLPS  -4.17 deficit   1.90 prct   0.00 CutScore  79.95;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE G 2301 U 2107'

 matches the original group, cWW-L-cWW
Better:   2 Equal:   0 Score 0.00               UAA*UG (   1) MLPS  -4.43 deficit   2.17 prct   0.00 CutScore  77.19;  Ed  0, 0
ans =

    ' IL_31462.6  8VFS U   10 G   19'

 scores better against   2 groups: IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.84, deficit  0.68, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -4.06, deficit  0.73, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               GAC*GU (   1) MLPS  -4.52 deficit   2.25 prct   0.00 CutScore  76.30;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A G  337 U   26'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GU (   1) MLPS  -4.52 deficit   2.25 prct   0.00 CutScore  76.30;  Ed  0, 0
ans =

    ' IL_31462.6  8CRE G  337 U   26'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GU (   1) MLPS  -4.52 deficit   2.25 prct   0.00 CutScore  76.30;  Ed  0, 0
ans =

    ' IL_31462.6  3CGS G   20 U    6'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAC*GU (   1) MLPS  -4.52 deficit   2.25 prct   0.00 CutScore  76.30;  Ed  0, 0
ans =

    ' IL_31462.6  4LFB G  396 U   45'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAU*GC (   1) MLPS  -4.79 deficit   2.53 prct   0.00 CutScore  73.42;  Ed  0, 0
ans =

    ' IL_31462.6  7A0S G 1963 C 1762'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAU*GC (   1) MLPS  -4.79 deficit   2.53 prct   0.00 CutScore  73.42;  Ed  0, 0
ans =

    ' IL_31462.6  5J7L G 1980 C 1771'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GAU*GC (   1) MLPS  -4.79 deficit   2.53 prct   0.00 CutScore  73.42;  Ed  0, 0
ans =

    ' IL_31462.6  4WF9 G 2007 C 1798'

 matches the original group, cWW-L-cWW
Better:   2 Equal:   0 Score 0.00               CAG*UG (   1) MLPS  -5.65 deficit   3.38 prct   0.00 CutScore  64.42;  Ed  0, 0
ans =

    ' IL_31462.6  8P9A C  577 G  513'

 scores better against   2 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -5.44, deficit  2.70, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -5.51, deficit  1.95, prct   0.00; 
Group 134 is from IL_31737.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31737.3
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GAG*CAC (   1) MLPS  -4.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31737.3  4M4O G   26 C   41'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CAC (   1) MLPS  -4.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31737.3  4M6D G   26 C   41'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              GAC*GAU (   1) MLPS  -6.05 deficit   1.22 prct   0.00 CutScore  87.14;  Ed  0, 0
ans =

    ' IL_31737.3  4WF9 G 1266 U 1259'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              GAG*UAC (   1) MLPS  -6.15 deficit   1.31 prct   0.00 CutScore  86.18;  Ed  0, 0
ans =

    ' IL_31737.3  7A0S G 1241 C 1234'

 matches the original group, cWW-L-cWW
Better:   4 Equal:   0 Score 0.00             CAC*GAAG (   1) MLPS  -6.27 deficit   1.44 prct   0.00 CutScore  84.82;  Ed  0, 0
ans =

    ' IL_31737.3  2O3X C   30 G   19'

 scores better against   4 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.58, deficit  0.67, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -5.59, deficit -0.13, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -5.65, deficit  0.07, prct   0.00; 
Better:   4 Equal:   0 Score 0.00             CAC*GAAG (   1) MLPS  -6.27 deficit   1.44 prct   0.00 CutScore  84.82;  Ed  0, 0
ans =

    ' IL_31737.3  3C3Z C   15 G   10'

 scores better against   4 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.58, deficit  0.67, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -5.59, deficit -0.13, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -5.65, deficit  0.07, prct   0.00; 
Better:  14 Equal:   0 Score 0.00               AAG*CU (   1) MLPS  -6.30 deficit   1.47 prct   0.00 CutScore  84.50;  Ed  0, 0
ans =

    ' IL_31737.3  2GUN A   14 U    4'

 scores better against  14 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.06, deficit  0.79, prct   0.00; IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -3.36, deficit  0.19, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.44, deficit  0.00, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.55, deficit  0.00, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.60, deficit  0.38, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -6.72 deficit   1.89 prct   0.00 CutScore  80.13;  Ed  0, 0
ans =

    ' IL_31737.3  2ET8 G   41 C    6'

 scores better against   5 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.14, deficit  0.38, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -5.14, deficit  0.00, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  4, 0, MLPS -5.23, deficit  0.72, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.58, deficit  2.12, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -6.72 deficit   1.89 prct   0.00 CutScore  80.13;  Ed  0, 0
ans =

    ' IL_31737.3  2O3X G   42 C    7'

 scores better against   5 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.14, deficit  0.38, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -5.14, deficit  0.00, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  4, 0, MLPS -5.23, deficit  0.72, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.58, deficit  2.12, prct   0.00; 
Better:   7 Equal:   0 Score 0.00              CCG*CCG (   1) MLPS  -7.61 deficit   2.78 prct   0.00 CutScore  70.73;  Ed  0, 0
ans =

    ' IL_31737.3  8VFS C   14 G   16'

 scores better against   7 groups: IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.42, deficit  0.65, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 1, MLPS -6.96, deficit  3.98, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -7.00, deficit  1.87, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -7.03, deficit  4.23, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  2, 1, MLPS -7.32, deficit  2.86, prct   0.00; 
Better:   9 Equal:   0 Score 0.00             CGC*GACG (   1) MLPS  -9.01 deficit   4.18 prct   0.00 CutScore  56.05;  Ed  0, 0
ans =

    ' IL_31737.3  8UO6 C   41 G   63'

 scores better against   9 groups: IL_09990.4,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -6.37, deficit  1.92, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -6.65, deficit  1.73, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 2, MLPS -7.17, deficit  1.15, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 2, MLPS -7.31, deficit  1.74, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -7.63, deficit  1.66, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            UAA*UCUUG (   1) MLPS -12.02 deficit   7.19 prct   0.00 CutScore  24.34;  Ed  0, 0
ans =

    ' IL_31737.3  8CRE U 1030 G 1014'

 scores better against   4 groups: IL_44325.1,  6 NTs, cWW-cWH-cWW-L                           , Ed  4, 1, MLPS -9.12, deficit  3.30, prct   0.00; IL_10389.1,  8 NTs, cWW-L-cWW-L-cWW                         , Ed  4, 1, MLPS -9.62, deficit  2.71, prct   0.00; IL_47972.1,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  5, 2, MLPS -9.74, deficit  4.38, prct   0.00; IL_14177.2,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -11.83, deficit  6.51, prct   0.00; 
Group 142 is from IL_33761.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_33761.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   3 Equal:   0 Score 0.00               CAC*GG (   1) MLPS  -3.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_33761.2  8CRE C 2597 G 2587'

 scores better against   3 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -2.74, deficit  0.00, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.96, deficit  0.70, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.32, deficit  0.00, prct   0.00; 
Better:   3 Equal:   0 Score 0.00               GUC*GC (   1) MLPS  -4.31 deficit   0.52 prct   0.00 CutScore  94.51;  Ed  0, 0
ans =

    ' IL_33761.2  1J9H G    3 C   16'

 scores better against   3 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.28, deficit  0.13, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.13, deficit  0.91, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.23, deficit  0.90, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UGAC*GG (   1) MLPS  -5.32 deficit   1.53 prct   0.00 CutScore  83.93;  Ed  0, 0
ans =

    ' IL_33761.2  4LFB U  129 G  232'

 scores better against   1 groups: IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  1, 0, MLPS -5.22, deficit  1.72, prct   0.00; 
Group 226 is from IL_56987.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_56987.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GUUA*UC (   1) MLPS  -4.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_56987.1  5J7L G  930 C  848'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              CUUG*CG (   1) MLPS  -4.21 deficit   0.05 prct   0.00 CutScore  99.51;  Ed  0, 0
ans =

    ' IL_56987.1  6XJQ C   23 G   36'

 matches the original group, cWW-L-cWW
Better:   2 Equal:   0 Score 0.00              GUAC*GC (   1) MLPS  -4.67 deficit   0.51 prct   0.00 CutScore  94.66;  Ed  0, 0
ans =

    ' IL_56987.1  5DO4 G   16 C   11'

 scores better against   2 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.89, deficit  0.62, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.21, deficit  0.13, prct   0.00; 
Group 230 is from IL_57881.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_57881.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CCAUC*GGG (   1) MLPS  -6.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_57881.1  4V9F C  880 G  870'

 matches the original group, cWW-L-cWW
Group 240 is from IL_59877.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_59877.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GAUC*GC (   1) MLPS  -2.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_59877.1  1XJR G   28 C   20'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              UAUA*UG (   1) MLPS  -3.69 deficit   0.83 prct   0.00 CutScore  91.30;  Ed  0, 0
ans =

    ' IL_59877.1  5Y58 U  291 G  309'

 matches the original group, cWW-L-cWW
Group 246 is from IL_61258.15 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_61258.15
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  1S03 G    9 C   40'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  6XKO G   78 C   57'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  1S03 G    9 C   40'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  8CRE G 1774 C 1666'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  8P9A G 1778 C 1670'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  5J7L G 1731 C 1728'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  3DIL G   12 C   79'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  3D0U G    9 C   76'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  8P9A G  150 C    8'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  8CRE G  150 C    7'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  7A0S G  558 C  553'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCG*CC (   1) MLPS  -2.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61258.15  7A0S G  938 C  864'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCU*AC (   1) MLPS  -2.78 deficit   0.23 prct   0.00 CutScore  97.55;  Ed  0, 0
ans =

    ' IL_61258.15  3HHN G   46 C  113'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCU*AC (   1) MLPS  -2.78 deficit   0.23 prct   0.00 CutScore  97.55;  Ed  0, 0
ans =

    ' IL_61258.15  8F5G G    8 C   20'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCU*AC (   1) MLPS  -2.78 deficit   0.23 prct   0.00 CutScore  97.55;  Ed  0, 0
ans =

    ' IL_61258.15  3IVK G   46 C  113'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCU*AC (   1) MLPS  -2.78 deficit   0.23 prct   0.00 CutScore  97.55;  Ed  0, 0
ans =

    ' IL_61258.15  5F5H G   18 C    5'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCU*AC (   1) MLPS  -2.78 deficit   0.23 prct   0.00 CutScore  97.55;  Ed  0, 0
ans =

    ' IL_61258.15  5F5H G   18 C    5'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCU*AC (   1) MLPS  -2.78 deficit   0.23 prct   0.00 CutScore  97.55;  Ed  0, 0
ans =

    ' IL_61258.15  7A0S G 1488 C 1535'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCU*AC (   1) MLPS  -2.78 deficit   0.23 prct   0.00 CutScore  97.55;  Ed  0, 0
ans =

    ' IL_61258.15  3SNP G    7 C   25'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UCG*CA (   1) MLPS  -2.83 deficit   0.28 prct   0.00 CutScore  97.03;  Ed  0, 0
ans =

    ' IL_61258.15  1DQF U   15 A    4'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UCG*CA (   1) MLPS  -2.83 deficit   0.28 prct   0.00 CutScore  97.03;  Ed  0, 0
ans =

    ' IL_61258.15  7PMM U   33 A   14'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UCG*CA (   1) MLPS  -2.83 deficit   0.28 prct   0.00 CutScore  97.03;  Ed  0, 0
ans =

    ' IL_61258.15  1DQH U   15 A    4'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UCG*CA (   1) MLPS  -2.83 deficit   0.28 prct   0.00 CutScore  97.03;  Ed  0, 0
ans =

    ' IL_61258.15  5KPY U   25 A   44'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UCG*CA (   1) MLPS  -2.83 deficit   0.28 prct   0.00 CutScore  97.03;  Ed  0, 0
ans =

    ' IL_61258.15  6CK5 U   39 A   22'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UCG*CA (   1) MLPS  -2.83 deficit   0.28 prct   0.00 CutScore  97.03;  Ed  0, 0
ans =

    ' IL_61258.15  3SN2 U    7 A   25'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCC*GC (   1) MLPS  -3.03 deficit   0.48 prct   0.00 CutScore  94.91;  Ed  0, 0
ans =

    ' IL_61258.15  3W3S G   11 C   24'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GCC*GC (   1) MLPS  -3.03 deficit   0.48 prct   0.00 CutScore  94.91;  Ed  0, 0
ans =

    ' IL_61258.15  3SN2 G   18 C   14'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CCG*CG (   1) MLPS  -3.04 deficit   0.50 prct   0.00 CutScore  94.77;  Ed  0, 0
ans =

    ' IL_61258.15  4C7O C   31 G   13'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00               UCU*AA (   1) MLPS  -3.06 deficit   0.52 prct   0.00 CutScore  94.58;  Ed  0, 0
ans =

    ' IL_61258.15  9DE7 U    4 A   56'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -3.04, deficit  0.30, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               UCA*UA (   1) MLPS  -3.19 deficit   0.65 prct   0.00 CutScore  93.15;  Ed  0, 0
ans =

    ' IL_61258.15  7A0S U 1005 A 1171'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UCA*UA (   1) MLPS  -3.19 deficit   0.65 prct   0.00 CutScore  93.15;  Ed  0, 0
ans =

    ' IL_61258.15  8P9A U   24 A  601'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UCA*UA (   1) MLPS  -3.19 deficit   0.65 prct   0.00 CutScore  93.15;  Ed  0, 0
ans =

    ' IL_61258.15  8CRE U   24 A  599'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UCA*UA (   1) MLPS  -3.19 deficit   0.65 prct   0.00 CutScore  93.15;  Ed  0, 0
ans =

    ' IL_61258.15  8CRE U   90 A   68'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               ACU*AU (   1) MLPS  -3.36 deficit   0.82 prct   0.00 CutScore  91.37;  Ed  0, 0
ans =

    ' IL_61258.15  7KGA A   44 U   11'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               ACU*AU (   1) MLPS  -3.36 deficit   0.82 prct   0.00 CutScore  91.37;  Ed  0, 0
ans =

    ' IL_61258.15  6ZDP A 1346 U 1291'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               ACU*AU (   1) MLPS  -3.36 deficit   0.82 prct   0.00 CutScore  91.37;  Ed  0, 0
ans =

    ' IL_61258.15  7KGA A   44 U   11'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00               CCA*UG (   1) MLPS  -3.41 deficit   0.87 prct   0.00 CutScore  90.89;  Ed  0, 0
ans =

    ' IL_61258.15  9DFE C  994 G 1160'

 scores better against   1 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.25, deficit  0.08, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CCA*UG (   1) MLPS  -3.41 deficit   0.87 prct   0.00 CutScore  90.89;  Ed  0, 0
ans =

    ' IL_61258.15  5J7L C  994 G 1160'

 scores better against   1 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.25, deficit  0.08, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CCA*UG (   1) MLPS  -3.41 deficit   0.87 prct   0.00 CutScore  90.89;  Ed  0, 0
ans =

    ' IL_61258.15  4WF9 C 1038 G 1204'

 scores better against   1 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.25, deficit  0.08, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CCC*GG (   1) MLPS  -3.52 deficit   0.98 prct   0.00 CutScore  89.69;  Ed  0, 0
ans =

    ' IL_61258.15  1KUQ C   46 G   22'

 scores better against   1 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.24, deficit  0.07, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UCC*GG (   1) MLPS  -5.14 deficit   2.59 prct   0.00 CutScore  72.70;  Ed  0, 0
ans =

    ' IL_61258.15  9DFE U 2878 G 2839'

 scores better against   1 groups: IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -4.13, deficit  0.81, prct   0.00; 
Group 250 is from IL_61438.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_61438.4
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CAAG*CCG (   1) MLPS  -2.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61438.4  8P9A C 1764 G 1638'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00             CAAG*CCG (   1) MLPS  -2.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61438.4  8CRE C 1751 G 1625'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00             CAAG*CCG (   1) MLPS  -2.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61438.4  5J7L C 1501 G 1401'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00             CAAG*CCG (   1) MLPS  -2.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61438.4  4LFB C 1501 G 1401'

 matches the original group, cWW-L-cWW
Group 257 is from IL_63775.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_63775.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00               CCG*CG (   1) MLPS  -3.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_63775.1  5O6U C    3 G   25'

 scores better against   1 groups: IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.04, deficit  0.50, prct   0.00; 
Group 268 is from IL_66635.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_66635.5
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   3 Equal:   0 Score 0.00               GGC*GC (   1) MLPS  -4.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_66635.5  1U9S G  217 C  196'

 scores better against   3 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.39, deficit  0.22, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.53, deficit  0.40, prct   0.00; IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.54, deficit  0.37, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              GGUC*GC (   1) MLPS  -5.01 deficit   0.28 prct   0.00 CutScore  97.01;  Ed  0, 0
ans =

    ' IL_66635.5  5T83 G   33 C   23'

 scores better against   2 groups: IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  2, 0, MLPS -3.47, deficit -0.03, prct   0.00; IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -4.47, deficit  1.61, prct   0.00; 
Better:   3 Equal:   0 Score 0.00               UGG*CG (   1) MLPS  -5.04 deficit   0.32 prct   0.00 CutScore  96.65;  Ed  0, 0
ans =

    ' IL_66635.5  7OAX U    8 G   45'

 scores better against   3 groups: IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.16, deficit  0.00, prct   0.00; IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.68, deficit  0.51, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -4.95, deficit  1.62, prct   0.00; 
Better:   3 Equal:   0 Score 0.00               GGU*AC (   1) MLPS  -5.04 deficit   0.32 prct   0.00 CutScore  96.64;  Ed  0, 0
ans =

    ' IL_66635.5  5WT1 G   43 C   27'

 scores better against   3 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.41, deficit  0.24, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.55, deficit  0.42, prct   0.00; IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.00, deficit  0.83, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               UGC*GG (   1) MLPS  -5.11 deficit   0.38 prct   0.00 CutScore  95.97;  Ed  0, 0
ans =

    ' IL_66635.5  7MLW U   43 G   18'

 scores better against   2 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.17, deficit  0.00, prct   0.00; IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.51, deficit  0.35, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               UGC*GG (   1) MLPS  -5.11 deficit   0.38 prct   0.00 CutScore  95.97;  Ed  0, 0
ans =

    ' IL_66635.5  6JQ6 U   62 G   32'

 scores better against   2 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.17, deficit  0.00, prct   0.00; IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.51, deficit  0.35, prct   0.00; 
Better:   3 Equal:   0 Score 0.00               CGC*GG (   1) MLPS  -5.15 deficit   0.43 prct   0.00 CutScore  95.48;  Ed  0, 0
ans =

    ' IL_66635.5  9FN3 C   29 G   16'

 scores better against   3 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.22, deficit  0.05, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.33, deficit  0.20, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -4.75, deficit  1.43, prct   0.00; 
Better:   3 Equal:   0 Score 0.00               CGC*GG (   1) MLPS  -5.15 deficit   0.43 prct   0.00 CutScore  95.48;  Ed  0, 0
ans =

    ' IL_66635.5  1NTA C    5 G  115'

 scores better against   3 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.22, deficit  0.05, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.33, deficit  0.20, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -4.75, deficit  1.43, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              GUUG*CC (   1) MLPS  -5.33 deficit   0.61 prct   0.00 CutScore  93.63;  Ed  0, 0
ans =

    ' IL_66635.5  8K85 G   36 C   16'

 scores better against   3 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.15, deficit -0.01, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  0, 0, MLPS -4.28, deficit  0.00, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -5.10, deficit  0.07, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              GUUG*CC (   1) MLPS  -5.33 deficit   0.61 prct   0.00 CutScore  93.63;  Ed  0, 0
ans =

    ' IL_66635.5  4KZD G   49 C   31'

 scores better against   3 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.15, deficit -0.01, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  0, 0, MLPS -4.28, deficit  0.00, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -5.10, deficit  0.07, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              GUUG*CC (   1) MLPS  -5.33 deficit   0.61 prct   0.00 CutScore  93.63;  Ed  0, 0
ans =

    ' IL_66635.5  7L0Z G   41 C   24'

 scores better against   3 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.15, deficit -0.01, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  0, 0, MLPS -4.28, deficit  0.00, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -5.10, deficit  0.07, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              GUUG*CC (   1) MLPS  -5.33 deficit   0.61 prct   0.00 CutScore  93.63;  Ed  0, 0
ans =

    ' IL_66635.5  8K85 G   36 C   16'

 scores better against   3 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.15, deficit -0.01, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  0, 0, MLPS -4.28, deficit  0.00, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -5.10, deficit  0.07, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              GAUG*CC (   1) MLPS  -5.60 deficit   0.87 prct   0.00 CutScore  90.81;  Ed  0, 0
ans =

    ' IL_66635.5  1XOK G  877 C  869'

 scores better against   2 groups: IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  1, 0, MLPS -4.47, deficit  0.03, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -5.10, deficit  0.07, prct   0.00; 
Better:   5 Equal:   0 Score 0.00               UAC*GG (   1) MLPS  -5.76 deficit   1.04 prct   0.00 CutScore  89.08;  Ed  0, 0
ans =

    ' IL_66635.5  5J7L U 2878 G 2839'

 scores better against   5 groups: IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.68, deficit  0.35, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.77, deficit  1.50, prct   0.00; IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.95, deficit  0.79, prct   0.00; IL_33761.2,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.96, deficit  0.16, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -5.02, deficit  2.28, prct   0.00; 
Better:   5 Equal:   0 Score 0.00               UAC*GG (   1) MLPS  -5.76 deficit   1.04 prct   0.00 CutScore  89.08;  Ed  0, 0
ans =

    ' IL_66635.5  4WF9 U 2898 G 2859'

 scores better against   5 groups: IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.68, deficit  0.35, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.77, deficit  1.50, prct   0.00; IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.95, deficit  0.79, prct   0.00; IL_33761.2,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.96, deficit  0.16, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -5.02, deficit  2.28, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              AUUG*CU (   1) MLPS  -5.77 deficit   1.05 prct   0.00 CutScore  88.98;  Ed  0, 0
ans =

    ' IL_66635.5  5LYS A   39 U   68'

 scores better against   3 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.28, deficit  0.12, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  0, 0, MLPS -4.54, deficit  0.27, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -5.22, deficit  0.19, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              GGAC*GC (   1) MLPS  -5.85 deficit   1.13 prct   0.00 CutScore  88.09;  Ed  0, 0
ans =

    ' IL_66635.5  6DLR G   36 C   23'

 scores better against   5 groups: IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  2, 0, MLPS -3.40, deficit -0.10, prct   0.00; IL_02555.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -4.37, deficit  2.07, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -4.61, deficit  0.53, prct   0.00; IL_33761.2,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -5.16, deficit  1.37, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -5.66, deficit  1.73, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              AAUG*CU (   1) MLPS  -6.04 deficit   1.32 prct   0.00 CutScore  86.15;  Ed  0, 0
ans =

    ' IL_66635.5  1XOK A  864 U  847'

 scores better against   5 groups: IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.54, deficit  0.10, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -5.22, deficit  0.19, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  1, 1, MLPS -5.67, deficit  0.82, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -5.80, deficit  1.87, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  1, 0, MLPS -5.89, deficit  1.62, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              GGAA*UC (   1) MLPS  -6.13 deficit   1.40 prct   0.00 CutScore  85.22;  Ed  0, 0
ans =

    ' IL_66635.5  387D G   15 C    2'

 scores better against   5 groups: IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  0, 0, MLPS -4.09, deficit  0.59, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -4.85, deficit  0.78, prct   0.00; IL_14368.1,  6 NTs, cWW-L-cWW-cSH                           , Ed  3, 1, MLPS -5.08, deficit  2.66, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -5.80, deficit  1.87, prct   0.00; IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -6.09, deficit  1.59, prct   0.00; 
Better:  12 Equal:   0 Score 0.00              GUAC*GC (   1) MLPS  -6.24 deficit   1.52 prct   0.00 CutScore  84.03;  Ed  0, 0
ans =

    ' IL_66635.5  3DD2 G   16 C   11'

 scores better against  12 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.89, deficit  0.62, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.21, deficit  0.13, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.67, deficit  0.51, prct   0.00; IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -5.05, deficit  1.10, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  2, 1, MLPS -5.57, deficit  0.76, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              UGAA*UG (   1) MLPS  -6.51 deficit   1.79 prct   0.00 CutScore  81.18;  Ed  0, 0
ans =

    ' IL_66635.5  9DFE U 1898 G 1842'

 scores better against   2 groups: IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  1, 0, MLPS -5.72, deficit  1.23, prct   0.00; IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  1, 0, MLPS -5.91, deficit  2.41, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              UGAA*UG (   1) MLPS  -6.51 deficit   1.79 prct   0.00 CutScore  81.18;  Ed  0, 0
ans =

    ' IL_66635.5  7A0S U 1881 G 1834'

 scores better against   2 groups: IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  1, 0, MLPS -5.72, deficit  1.23, prct   0.00; IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  1, 0, MLPS -5.91, deficit  2.41, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              UGAU*AG (   1) MLPS  -6.56 deficit   1.83 prct   0.00 CutScore  80.70;  Ed  0, 0
ans =

    ' IL_66635.5  7VTI U   27 G   10'

 scores better against   3 groups: IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -5.65, deficit  1.16, prct   0.00; IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  1, 0, MLPS -6.06, deficit  2.56, prct   0.00; IL_33761.2,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -6.52, deficit  2.73, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              GUCG*CC (   1) MLPS  -6.76 deficit   2.04 prct   0.00 CutScore  78.53;  Ed  0, 0
ans =

    ' IL_66635.5  8K7W G   30 C   15'

 scores better against   5 groups: IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -5.10, deficit  0.07, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.76, deficit  1.60, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  0, 0, MLPS -6.00, deficit  1.16, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -6.59, deficit  2.52, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -6.60, deficit  1.79, prct   0.00; 
Better:   6 Equal:   0 Score 0.00              GCUG*CC (   1) MLPS  -7.06 deficit   2.34 prct   0.00 CutScore  75.37;  Ed  0, 0
ans =

    ' IL_66635.5  5LYS G   70 C   37'

 scores better against   6 groups: IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -5.75, deficit  1.80, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -6.00, deficit  1.16, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -6.10, deficit  1.94, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -6.19, deficit  1.17, prct   0.00; IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 1, MLPS -6.67, deficit  2.23, prct   0.00; 
Better:  11 Equal:   0 Score 0.00              CUGG*CG (   1) MLPS  -7.70 deficit   2.98 prct   0.00 CutScore  68.63;  Ed  0, 0
ans =

    ' IL_66635.5  6CF2 C   22 G   11'

 scores better against  11 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -5.82, deficit  1.66, prct   0.00; IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -5.87, deficit  2.50, prct   0.00; IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  5, 2, MLPS -6.31, deficit  3.45, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -6.31, deficit  1.29, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  4, 1, MLPS -6.66, deficit  1.85, prct   0.00; 
Better:   9 Equal:   0 Score 0.00             AUCUG*CU (   1) MLPS -10.48 deficit   5.76 prct   0.00 CutScore  39.40;  Ed  0, 0
ans =

    ' IL_66635.5  6XH2 A   22 U   40'

 scores better against   9 groups: IL_94967.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -6.49, deficit  1.26, prct   0.00; IL_20031.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -7.84, deficit  1.17, prct   0.00; IL_47078.3,  7 NTs, cWW-cWS-L-cWW-L                         , Ed  5, 2, MLPS -8.09, deficit  2.71, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  4, 2, MLPS -8.61, deficit  3.04, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  4, 1, MLPS -8.89, deficit  4.62, prct   0.00; 
Group 300 is from IL_73452.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_73452.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   3 Equal:   0 Score 0.00              CUAG*CG (   1) MLPS  -5.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_73452.2  8S95 C   78 G  109'

 scores better against   3 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.60, deficit  1.34, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.72, deficit  0.56, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.56, deficit  0.75, prct   0.00; 
Better:   8 Equal:   0 Score 0.00               GUC*GC (   1) MLPS  -5.77 deficit   0.20 prct   0.00 CutScore  97.91;  Ed  0, 0
ans =

    ' IL_73452.2  1J9H G   12 C    7'

 scores better against   8 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.28, deficit  0.13, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.13, deficit  0.91, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.23, deficit  0.90, prct   0.00; IL_33761.2,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.31, deficit  0.52, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -4.87, deficit  0.36, prct   0.00; 
Better:   0 Equal:   0 Score 1.00             GAAUG*CC (   1) MLPS  -6.88 deficit   1.31 prct   0.00 CutScore  86.23;  Ed  0, 0
ans =

    ' IL_73452.2  1F1T G   29 C    7'

 matches the original group, cWW-L-cWW
Group 337 is from IL_81831.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_81831.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   5 Equal:   0 Score 0.00               GUA*UC (   1) MLPS  -4.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_81831.1  3WBM G    2 C   24'

 scores better against   5 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.79, deficit  0.64, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.93, deficit  0.70, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -4.09, deficit  0.54, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -4.53, deficit  1.21, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  3, 1, MLPS -4.62, deficit  0.11, prct   0.00; 
Better:   7 Equal:   0 Score 0.00              UAAG*CA (   1) MLPS  -5.50 deficit   0.69 prct   0.00 CutScore  92.70;  Ed  0, 0
ans =

    ' IL_81831.1  4R4V U  719 A  756'

 scores better against   7 groups: IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -4.18, deficit  0.25, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.26, deficit  0.19, prct   0.00; IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -4.27, deficit  1.00, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  1, 1, MLPS -4.94, deficit  0.09, prct   0.00; IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  1, 0, MLPS -4.96, deficit  0.47, prct   0.00; 
Group 377 is from IL_89505.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_89505.4
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE G 1203 C 1293'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  9DFE G 2067 C 2443'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A G 1207 C 1297'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A G 1051 C 1067'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  7VTI G   21 C   15'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  4V9F G 1108 C 1254'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  3D2V G   73 C    6'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  5J7L G 2067 C 2443'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  7A0S G 2050 C 2422'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  4WF9 G 2094 C 2470'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  4V9F G   86 C   96'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  5J7L G 1048 C 1209'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE G 1253 C 1427'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A G 1268 C 1441'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  4FRG G   23 C   40'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  4LFB G 1048 C 1209'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  8VMB G   40 C   37'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  2A64 G   66 C   78'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  4V9F G  834 C  848'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE G 1556 C 1574'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  8VMA G   40 C   37'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE G  277 C  274'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  6JDV G   95 C   82'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  2ZY6 G   10 C   25'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A G  279 C  276'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  1ET4 G  226 C  219'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*CC (   1) MLPS  -2.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89505.4  3W3S G   43 C   27'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE G  555 C  585'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A G  557 C  587'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  9DFE G 1011 C 1150'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  2A64 G   51 C  396'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  5J7L G 1011 C 1150'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  5J7L G 1459 C 1451'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  4V9F G  307 C  323'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  4O26 G  181 C  194'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  8KAL G   58 C   55'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  5FQ5 G   58 C   55'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  7QQP G   58 C   55'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  7QR8 G   58 C   55'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  7QQX G   58 C   55'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  5B2T G   58 C   55'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  7QR0 G   58 C   55'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  7ZO1 G   58 C   55'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  5VW1 G   58 C   55'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  8KAJ G   58 C   55'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUC*GC (   1) MLPS  -2.28 deficit   0.13 prct   0.00 CutScore  98.63;  Ed  0, 0
ans =

    ' IL_89505.4  5F9R G   76 C   73'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUA*UC (   1) MLPS  -2.79 deficit   0.64 prct   0.00 CutScore  93.29;  Ed  0, 0
ans =

    ' IL_89505.4  7KVT G   50 C   67'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUA*UC (   1) MLPS  -2.79 deficit   0.64 prct   0.00 CutScore  93.29;  Ed  0, 0
ans =

    ' IL_89505.4  8TQX G   14 C    5'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUA*UC (   1) MLPS  -2.79 deficit   0.64 prct   0.00 CutScore  93.29;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE G 3305 C 3329'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUA*UC (   1) MLPS  -2.79 deficit   0.64 prct   0.00 CutScore  93.29;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A G 3318 C 3388'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUA*UC (   1) MLPS  -2.79 deficit   0.64 prct   0.00 CutScore  93.29;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE G 3283 C 3353'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUA*UC (   1) MLPS  -2.79 deficit   0.64 prct   0.00 CutScore  93.29;  Ed  0, 0
ans =

    ' IL_89505.4  3WBM G    2 C   24'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUA*UC (   1) MLPS  -2.79 deficit   0.64 prct   0.00 CutScore  93.29;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A G 3340 C 3364'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUA*UC (   1) MLPS  -2.79 deficit   0.64 prct   0.00 CutScore  93.29;  Ed  0, 0
ans =

    ' IL_89505.4  8TQX G   14 C    5'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUA*UC (   1) MLPS  -2.79 deficit   0.64 prct   0.00 CutScore  93.29;  Ed  0, 0
ans =

    ' IL_89505.4  4C7O G   38 C    8'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUU*AC (   1) MLPS  -2.85 deficit   0.70 prct   0.00 CutScore  92.59;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE G 2387 C 2784'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUU*AC (   1) MLPS  -2.85 deficit   0.70 prct   0.00 CutScore  92.59;  Ed  0, 0
ans =

    ' IL_89505.4  6LT7 G   46 C   42'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUU*AC (   1) MLPS  -2.85 deficit   0.70 prct   0.00 CutScore  92.59;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A G 2409 C 2812'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUU*AC (   1) MLPS  -2.85 deficit   0.70 prct   0.00 CutScore  92.59;  Ed  0, 0
ans =

    ' IL_89505.4  2OIU G   18 C   42'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUU*AC (   1) MLPS  -2.85 deficit   0.70 prct   0.00 CutScore  92.59;  Ed  0, 0
ans =

    ' IL_89505.4  2PJP G   16 C   30'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUU*AC (   1) MLPS  -2.85 deficit   0.70 prct   0.00 CutScore  92.59;  Ed  0, 0
ans =

    ' IL_89505.4  2R8S G  129 C  193'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUU*AC (   1) MLPS  -2.85 deficit   0.70 prct   0.00 CutScore  92.59;  Ed  0, 0
ans =

    ' IL_89505.4  3SNP G   18 C   14'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUU*AC (   1) MLPS  -2.85 deficit   0.70 prct   0.00 CutScore  92.59;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A G  189 C  205'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUU*AC (   1) MLPS  -2.85 deficit   0.70 prct   0.00 CutScore  92.59;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE G  188 C  204'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUG*CU (   1) MLPS  -2.93 deficit   0.79 prct   0.00 CutScore  91.73;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE A 1176 U 1321'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUG*CU (   1) MLPS  -2.93 deficit   0.79 prct   0.00 CutScore  91.73;  Ed  0, 0
ans =

    ' IL_89505.4  4V9F A 2108 U 2478'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUG*CU (   1) MLPS  -2.93 deficit   0.79 prct   0.00 CutScore  91.73;  Ed  0, 0
ans =

    ' IL_89505.4  7A0S A 1022 U 1161'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUG*CU (   1) MLPS  -2.93 deficit   0.79 prct   0.00 CutScore  91.73;  Ed  0, 0
ans =

    ' IL_89505.4  6M0X A   59 U   56'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUG*CU (   1) MLPS  -2.93 deficit   0.79 prct   0.00 CutScore  91.73;  Ed  0, 0
ans =

    ' IL_89505.4  1S03 A    6 U   42'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUG*CU (   1) MLPS  -2.93 deficit   0.79 prct   0.00 CutScore  91.73;  Ed  0, 0
ans =

    ' IL_89505.4  1S03 A    6 U   42'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUC*GU (   1) MLPS  -3.06 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A A   89 U   69'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUC*GU (   1) MLPS  -3.06 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE A   12 U  145'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUC*GU (   1) MLPS  -3.06 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A A   13 U  145'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUC*GU (   1) MLPS  -3.06 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0
ans =

    ' IL_89505.4  8F5G A    5 U   22'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUC*GU (   1) MLPS  -3.06 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0
ans =

    ' IL_89505.4  6JQ5 A   38 U   56'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUC*GU (   1) MLPS  -3.06 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0
ans =

    ' IL_89505.4  6JQ5 A   38 U   56'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUC*GU (   1) MLPS  -3.06 deficit   0.92 prct   0.00 CutScore  90.36;  Ed  0, 0
ans =

    ' IL_89505.4  6JQ6 A   38 U   56'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUG*CG (   1) MLPS  -3.20 deficit   1.05 prct   0.00 CutScore  88.98;  Ed  0, 0
ans =

    ' IL_89505.4  3MEI C   15 G    8'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUG*CG (   1) MLPS  -3.20 deficit   1.05 prct   0.00 CutScore  88.98;  Ed  0, 0
ans =

    ' IL_89505.4  4LFB C 1195 G 1061'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUG*CG (   1) MLPS  -3.20 deficit   1.05 prct   0.00 CutScore  88.98;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE C  869 G  883'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUG*CG (   1) MLPS  -3.20 deficit   1.05 prct   0.00 CutScore  88.98;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A C  873 G  887'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUG*CG (   1) MLPS  -3.20 deficit   1.05 prct   0.00 CutScore  88.98;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A C 2204 G 2238'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUG*CG (   1) MLPS  -3.20 deficit   1.05 prct   0.00 CutScore  88.98;  Ed  0, 0
ans =

    ' IL_89505.4  2UWM C   25 G   22'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUG*CG (   1) MLPS  -3.20 deficit   1.05 prct   0.00 CutScore  88.98;  Ed  0, 0
ans =

    ' IL_89505.4  4KZD C   74 G   11'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUG*CG (   1) MLPS  -3.20 deficit   1.05 prct   0.00 CutScore  88.98;  Ed  0, 0
ans =

    ' IL_89505.4  5LYS C   62 G   46'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUG*CA (   1) MLPS  -3.29 deficit   1.14 prct   0.00 CutScore  87.95;  Ed  0, 0
ans =

    ' IL_89505.4  5J7L U  367 A  393'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUC*GG (   1) MLPS  -3.33 deficit   1.18 prct   0.00 CutScore  87.61;  Ed  0, 0
ans =

    ' IL_89505.4  3NDB C  139 G  238'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUC*GG (   1) MLPS  -3.33 deficit   1.18 prct   0.00 CutScore  87.61;  Ed  0, 0
ans =

    ' IL_89505.4  3IWN C   42 G   82'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               CUC*GG (   1) MLPS  -3.33 deficit   1.18 prct   0.00 CutScore  87.61;  Ed  0, 0
ans =

    ' IL_89505.4  3MXH C   52 G   87'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00               UUC*GA (   1) MLPS  -3.42 deficit   1.27 prct   0.00 CutScore  86.58;  Ed  0, 0
ans =

    ' IL_89505.4  4LFB U  367 A  393'

 scores better against   1 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.41, deficit  0.24, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UUC*GA (   1) MLPS  -3.42 deficit   1.27 prct   0.00 CutScore  86.58;  Ed  0, 0
ans =

    ' IL_89505.4  6MWN U  659 A  647'

 scores better against   1 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.41, deficit  0.24, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UUC*GA (   1) MLPS  -3.42 deficit   1.27 prct   0.00 CutScore  86.58;  Ed  0, 0
ans =

    ' IL_89505.4  7A0S U 2197 A 2187'

 scores better against   1 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.41, deficit  0.24, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               AUA*UU (   1) MLPS  -3.57 deficit   1.42 prct   0.00 CutScore  85.02;  Ed  0, 0
ans =

    ' IL_89505.4  4WF9 A 1055 U 1194'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUA*UU (   1) MLPS  -3.57 deficit   1.42 prct   0.00 CutScore  85.02;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A A 1180 U 1325'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUA*UU (   1) MLPS  -3.57 deficit   1.42 prct   0.00 CutScore  85.02;  Ed  0, 0
ans =

    ' IL_89505.4  7PMQ A   24 U   41'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUA*UU (   1) MLPS  -3.57 deficit   1.42 prct   0.00 CutScore  85.02;  Ed  0, 0
ans =

    ' IL_89505.4  7PMM A   15 U   32'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUU*AU (   1) MLPS  -3.64 deficit   1.49 prct   0.00 CutScore  84.32;  Ed  0, 0
ans =

    ' IL_89505.4  4WF9 A  969 U  898'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUU*AU (   1) MLPS  -3.64 deficit   1.49 prct   0.00 CutScore  84.32;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A A  775 U  756'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               AUU*AU (   1) MLPS  -3.64 deficit   1.49 prct   0.00 CutScore  84.32;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE A  771 U  752'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUG*CG (   1) MLPS  -3.71 deficit   1.56 prct   0.00 CutScore  83.55;  Ed  0, 0
ans =

    ' IL_89505.4  8K85 U   30 G   21'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUG*CG (   1) MLPS  -3.71 deficit   1.56 prct   0.00 CutScore  83.55;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A U 3381 G 3325'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUG*CG (   1) MLPS  -3.71 deficit   1.56 prct   0.00 CutScore  83.55;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE U 3346 G 3290'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUG*CG (   1) MLPS  -3.71 deficit   1.56 prct   0.00 CutScore  83.55;  Ed  0, 0
ans =

    ' IL_89505.4  8K85 U   30 G   21'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUC*GG (   1) MLPS  -3.84 deficit   1.69 prct   0.00 CutScore  82.18;  Ed  0, 0
ans =

    ' IL_89505.4  6UFH U  139 G  155'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUC*GG (   1) MLPS  -3.84 deficit   1.69 prct   0.00 CutScore  82.18;  Ed  0, 0
ans =

    ' IL_89505.4  6UFG U  138 G  154'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUC*GG (   1) MLPS  -3.84 deficit   1.69 prct   0.00 CutScore  82.18;  Ed  0, 0
ans =

    ' IL_89505.4  3CUL U   17 G    2'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUC*GG (   1) MLPS  -3.84 deficit   1.69 prct   0.00 CutScore  82.18;  Ed  0, 0
ans =

    ' IL_89505.4  5J7L U 2401 G 2415'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUC*GG (   1) MLPS  -3.84 deficit   1.69 prct   0.00 CutScore  82.18;  Ed  0, 0
ans =

    ' IL_89505.4  3KTW U  178 G  153'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUC*GG (   1) MLPS  -3.84 deficit   1.69 prct   0.00 CutScore  82.18;  Ed  0, 0
ans =

    ' IL_89505.4  4WF9 U 2428 G 2442'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00               UUA*UA (   1) MLPS  -3.93 deficit   1.78 prct   0.00 CutScore  81.24;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A U  439 A  464'

 scores better against   1 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.41, deficit  0.25, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UUA*UA (   1) MLPS  -3.93 deficit   1.78 prct   0.00 CutScore  81.24;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE U  437 A  462'

 scores better against   1 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.41, deficit  0.25, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               GUG*UC (   1) MLPS  -4.12 deficit   1.97 prct   0.00 CutScore  79.27;  Ed  0, 0
ans =

    ' IL_89505.4  2PN3 G  105 C   62'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               GUG*UC (   1) MLPS  -4.12 deficit   1.97 prct   0.00 CutScore  79.27;  Ed  0, 0
ans =

    ' IL_89505.4  3TZR G  105 C   62'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUU*AG (   1) MLPS  -4.42 deficit   2.27 prct   0.00 CutScore  76.14;  Ed  0, 0
ans =

    ' IL_89505.4  7KKV U  497 G  507'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUG*UA (   1) MLPS  -5.26 deficit   3.11 prct   0.00 CutScore  67.23;  Ed  0, 0
ans =

    ' IL_89505.4  8CRE U 1643 A 1731'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00               UUG*UA (   1) MLPS  -5.26 deficit   3.11 prct   0.00 CutScore  67.23;  Ed  0, 0
ans =

    ' IL_89505.4  8P9A U 1656 A 1744'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00               UUG*UG (   1) MLPS  -5.68 deficit   3.53 prct   0.00 CutScore  62.82;  Ed  0, 0
ans =

    ' IL_89505.4  5J7L U 2202 G 2221'

 scores better against   1 groups: IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -5.15, deficit  1.99, prct   0.00; 
Group 381 is from IL_90729.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_90729.1
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90729.1  4WF9 G  215 C  187'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90729.1  5J7L G  212 C  184'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90729.1  9DFE G  212 C  184'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90729.1  8CRE G   55 C   27'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90729.1  8P9A G   56 C   28'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90729.1  4V9F G  182 C  154'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90729.1  5J7L G  940 C  838'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90729.1  9DFE G  940 C  838'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90729.1  7A0S G  951 C  851'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -3.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_90729.1  4WF9 G  984 C  883'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GUG*CC (   1) MLPS  -3.59 deficit   0.36 prct   0.00 CutScore  96.20;  Ed  0, 0
ans =

    ' IL_90729.1  8CRE G 1772 C 1667'

 scores better against   1 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.15, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GUG*CC (   1) MLPS  -3.59 deficit   0.36 prct   0.00 CutScore  96.20;  Ed  0, 0
ans =

    ' IL_90729.1  8P9A G 1776 C 1671'

 scores better against   1 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.15, deficit  0.00, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               AAG*CU (   1) MLPS  -3.60 deficit   0.38 prct   0.00 CutScore  96.04;  Ed  0, 0
ans =

    ' IL_90729.1  7A0S A  189 U  161'

 scores better against   4 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.06, deficit  0.79, prct   0.00; IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -3.36, deficit  0.19, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.44, deficit  0.00, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.55, deficit  0.00, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               GAU*AC (   1) MLPS  -3.74 deficit   0.51 prct   0.00 CutScore  94.62;  Ed  0, 0
ans =

    ' IL_90729.1  7MLX G   48 C   38'

 scores better against   2 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.10, deficit  0.83, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.62, deficit  0.19, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               CAA*UG (   1) MLPS  -3.82 deficit   0.60 prct   0.00 CutScore  93.70;  Ed  0, 0
ans =

    ' IL_90729.1  8P9A C  163 G  258'

 scores better against   4 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.21, deficit  0.47, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.63, deficit  1.36, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.70, deficit  0.38, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.75, deficit  0.32, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               CAA*UG (   1) MLPS  -3.82 deficit   0.60 prct   0.00 CutScore  93.70;  Ed  0, 0
ans =

    ' IL_90729.1  4V83 C 6155 G 6173'

 scores better against   4 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.21, deficit  0.47, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.63, deficit  1.36, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.70, deficit  0.38, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.75, deficit  0.32, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               CAA*UG (   1) MLPS  -3.82 deficit   0.60 prct   0.00 CutScore  93.70;  Ed  0, 0
ans =

    ' IL_90729.1  3MOJ C 2540 G 2523'

 scores better against   4 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.21, deficit  0.47, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.63, deficit  1.36, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.70, deficit  0.38, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.75, deficit  0.32, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               CUG*CG (   1) MLPS  -3.84 deficit   0.62 prct   0.00 CutScore  93.52;  Ed  0, 0
ans =

    ' IL_90729.1  8P9A C   47 G   30'

 scores better against   1 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.20, deficit  1.05, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               AUG*CU (   1) MLPS  -3.96 deficit   0.74 prct   0.00 CutScore  92.24;  Ed  0, 0
ans =

    ' IL_90729.1  8CRE A  236 U  178'

 scores better against   1 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.93, deficit  0.79, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               AUG*CU (   1) MLPS  -3.96 deficit   0.74 prct   0.00 CutScore  92.24;  Ed  0, 0
ans =

    ' IL_90729.1  4C7O A   36 U    9'

 scores better against   1 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.93, deficit  0.79, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GUC*GC (   1) MLPS  -4.13 deficit   0.91 prct   0.00 CutScore  90.44;  Ed  0, 0
ans =

    ' IL_90729.1  5IBB G   63 C   51'

 scores better against   1 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.28, deficit  0.13, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               CUA*UG (   1) MLPS  -4.18 deficit   0.96 prct   0.00 CutScore  89.90;  Ed  0, 0
ans =

    ' IL_90729.1  7QR8 C   14 G    6'

 scores better against   4 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.83, deficit  1.68, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -4.04, deficit  0.48, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.12, deficit  0.80, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.14, deficit  1.40, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               CUA*UG (   1) MLPS  -4.18 deficit   0.96 prct   0.00 CutScore  89.90;  Ed  0, 0
ans =

    ' IL_90729.1  6FZ0 C   46 G   21'

 scores better against   4 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.83, deficit  1.68, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -4.04, deficit  0.48, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.12, deficit  0.80, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.14, deficit  1.40, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               CUA*UG (   1) MLPS  -4.18 deficit   0.96 prct   0.00 CutScore  89.90;  Ed  0, 0
ans =

    ' IL_90729.1  2QWY C   43 G   22'

 scores better against   4 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.83, deficit  1.68, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -4.04, deficit  0.48, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.12, deficit  0.80, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.14, deficit  1.40, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               CCG*CG (   1) MLPS  -5.37 deficit   2.14 prct   0.00 CutScore  77.45;  Ed  0, 0
ans =

    ' IL_90729.1  8OI5 C   47 G   30'

 scores better against   4 groups: IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.04, deficit  0.50, prct   0.00; IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.16, deficit  0.00, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.04, deficit  0.61, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -5.33, deficit  2.20, prct   0.00; 
Better:   6 Equal:   0 Score 0.00               GGG*CC (   1) MLPS  -5.62 deficit   2.40 prct   0.00 CutScore  74.76;  Ed  0, 0
ans =

    ' IL_90729.1  4LFB G 1002 C 1039'

 scores better against   6 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -3.31, deficit  0.15, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.33, deficit  0.20, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -4.02, deficit  0.46, prct   0.00; IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.05, deficit  0.88, prct   0.00; IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.66, deficit -0.06, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               ACU*AU (   1) MLPS  -6.00 deficit   2.77 prct   0.00 CutScore  70.79;  Ed  0, 0
ans =

    ' IL_90729.1  7KGA A   37 U   16'

 scores better against   4 groups: IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.36, deficit  0.82, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.27, deficit  0.84, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -5.15, deficit  2.41, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -5.77, deficit  2.64, prct   0.00; 
Better:   6 Equal:   0 Score 0.00               UUA*UG (   1) MLPS  -6.01 deficit   2.79 prct   0.00 CutScore  70.63;  Ed  0, 0
ans =

    ' IL_90729.1  7A0S U  942 G  861'

 scores better against   6 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.35, deficit  2.20, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -4.48, deficit  1.16, prct   0.00; IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.63, deficit  1.47, prct   0.00; IL_33761.2,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -5.68, deficit  1.89, prct   0.00; IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  2, 1, MLPS -5.77, deficit  1.04, prct   0.00; 
Better:  16 Equal:   0 Score 0.00              AAUU*AU (   1) MLPS  -7.71 deficit   4.48 prct   0.00 CutScore  52.79;  Ed  0, 0
ans =

    ' IL_90729.1  5J7L A  844 U  934'

 scores better against  16 groups: IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.60, deficit  0.17, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -5.16, deficit  0.13, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -5.81, deficit  1.88, prct   0.00; IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  2, 0, MLPS -5.86, deficit  2.37, prct   0.00; IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -6.07, deficit  1.58, prct   0.00; 
Better:  15 Equal:   0 Score 0.00              GUCC*GC (   1) MLPS  -7.73 deficit   4.50 prct   0.00 CutScore  52.58;  Ed  0, 0
ans =

    ' IL_90729.1  8P9A G 2770 C 2788'

 scores better against  15 groups: IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  0, 0, MLPS -5.03, deficit  0.00, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -5.77, deficit  1.61, prct   0.00; IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  2, 2, MLPS -6.08, deficit  3.22, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -6.46, deficit  2.38, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -6.52, deficit  1.67, prct   0.00; 
Group 394 is from IL_95583.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_95583.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CCGG*CG (   1) MLPS  -3.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_95583.2  5J7L C 1837 G 1903'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              CCGG*CG (   1) MLPS  -3.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_95583.2  9DFE C 1837 G 1903'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00              CCGG*CG (   1) MLPS  -3.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_95583.2  7A0S C 1829 G 1886'

 matches the original group, cWW-L-cWW
Better:   1 Equal:   0 Score 0.00              CAGC*GG (   1) MLPS  -4.44 deficit   0.60 prct   0.00 CutScore  93.71;  Ed  0, 0
ans =

    ' IL_95583.2  1U9S C  136 G  162'

 scores better against   1 groups: IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  0, 0, MLPS -4.41, deficit  0.33, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CCAG*CG (   1) MLPS  -4.60 deficit   0.76 prct   0.00 CutScore  92.02;  Ed  0, 0
ans =

    ' IL_95583.2  4V9F C 1893 G 1944'

 scores better against   1 groups: IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -4.49, deficit  0.54, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CCAG*CG (   1) MLPS  -4.60 deficit   0.76 prct   0.00 CutScore  92.02;  Ed  0, 0
ans =

    ' IL_95583.2  8P9A C 2196 G 2246'

 scores better against   1 groups: IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -4.49, deficit  0.54, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CCAG*CG (   1) MLPS  -4.60 deficit   0.76 prct   0.00 CutScore  92.02;  Ed  0, 0
ans =

    ' IL_95583.2  8CRE C 2174 G 2224'

 scores better against   1 groups: IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -4.49, deficit  0.54, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              UAAU*AG (   1) MLPS  -5.82 deficit   1.98 prct   0.00 CutScore  79.21;  Ed  0, 0
ans =

    ' IL_95583.2  3RW6 U   38 G   21'

 scores better against   3 groups: IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  1, 0, MLPS -4.42, deficit -0.07, prct   0.00; IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  3, 0, MLPS -5.55, deficit  1.12, prct   0.00; IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -5.56, deficit  2.20, prct   0.00; 
Better:   8 Equal:   0 Score 0.00              GAAG*CC (   1) MLPS  -5.87 deficit   2.03 prct   0.00 CutScore  78.65;  Ed  0, 0
ans =

    ' IL_95583.2  9DFE G 1846 C 1894'

 scores better against   8 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.26, deficit  0.00, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -4.17, deficit  0.24, prct   0.00; IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  0, 0, MLPS -4.98, deficit  0.54, prct   0.00; IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -5.01, deficit  0.52, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  2, 1, MLPS -5.03, deficit  0.18, prct   0.00; 
Better:   0 Equal:   0 Score 1.00             UCAGC*GG (   1) MLPS  -7.01 deficit   3.16 prct   0.00 CutScore  66.71;  Ed  0, 0
ans =

    ' IL_95583.2  4LFB U 1199 G 1058'

 matches the original group, cWW-L-cWW
Better:   0 Equal:   0 Score 1.00             UCAUC*GG (   1) MLPS  -8.12 deficit   4.27 prct   0.00 CutScore  55.02;  Ed  0, 0
ans =

    ' IL_95583.2  5J7L U 1199 G 1058'

 matches the original group, cWW-L-cWW
Group   3 is from IL_00881.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_00881.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00              CAAG*UG (   1) MLPS  -4.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00881.1  5J7L C 1507 G 1482'

 scores better against   1 groups: IL_02555.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.30, deficit  0.00, prct   0.00; 
Better:   0 Equal:   0 Score 1.00             CACAA*UG (   1) MLPS  -5.72 deficit   0.95 prct   0.00 CutScore  90.04;  Ed  0, 0
ans =

    ' IL_00881.1  9DFE C 1582 G 1416'

 matches the original group, cWW-L-cWW-L
Group  32 is from IL_07171.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_07171.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             ACGUG*UU (   1) MLPS  -4.84 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07171.1  4V9F A 2746 U 2733'

 matches the original group, cWW-L-cWW-L
Group  61 is from IL_15052.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_15052.4
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   2 Equal:   0 Score 0.00              AAAC*GU (   1) MLPS  -4.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15052.4  3MXH A   61 U   77'

 scores better against   2 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.85, deficit  0.59, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.07, deficit  0.14, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAAC*GU (   1) MLPS  -4.08 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15052.4  3IWN A   51 U   72'

 scores better against   2 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.85, deficit  0.59, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.07, deficit  0.14, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UAAC*GA (   1) MLPS  -4.13 deficit   0.05 prct   0.00 CutScore  99.45;  Ed  0, 0
ans =

    ' IL_15052.4  5J7L U   70 A   98'

 scores better against   1 groups: IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.06, deficit  0.13, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UAAU*AA (   1) MLPS  -4.32 deficit   0.24 prct   0.00 CutScore  97.45;  Ed  0, 0
ans =

    ' IL_15052.4  3RW6 U   53 A    8'

 scores better against   1 groups: IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -4.19, deficit  0.25, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUAG*CC (   1) MLPS  -4.34 deficit   0.26 prct   0.00 CutScore  97.24;  Ed  0, 0
ans =

    ' IL_15052.4  8OI5 G   49 C   29'

 scores better against   1 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -3.74, deficit  0.48, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUAG*CC (   1) MLPS  -4.34 deficit   0.26 prct   0.00 CutScore  97.24;  Ed  0, 0
ans =

    ' IL_15052.4  8P9A G   49 C   29'

 scores better against   1 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -3.74, deficit  0.48, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              CAGC*GG (   1) MLPS  -4.41 deficit   0.33 prct   0.00 CutScore  96.54;  Ed  0, 0
ans =

    ' IL_15052.4  5J7L C 1129 G 1143'

 matches the original group, cWW-L-cWW-L
Better:   1 Equal:   0 Score 0.00             CCAGC*GG (   1) MLPS  -7.00 deficit   2.93 prct   0.00 CutScore  69.21;  Ed  0, 0
ans =

    ' IL_15052.4  4LFB C 1128 G 1143'

 scores better against   1 groups: IL_95583.2,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -6.49, deficit  2.65, prct   0.00; 
Group  84 is from IL_20031.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_20031.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGGCG*CC (   1) MLPS  -6.67 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_20031.1  9E7E G    9 C   32'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00             CCCUU*AG (   1) MLPS  -6.67 deficit   0.00 prct   0.00 CutScore  99.99;  Ed  0, 0
ans =

    ' IL_20031.1  8D29 C   21 G   11'

 matches the original group, cWW-L-cWW-L
Group  94 is from IL_22551.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_22551.4
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GCAC*GC (   1) MLPS  -3.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22551.4  9DFE G 1964 C 1934'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00              GCAC*GC (   1) MLPS  -3.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22551.4  7A0S G 1947 C 1917'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00              GCAC*GC (   1) MLPS  -3.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22551.4  5J7L G 1964 C 1934'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00              GCAC*GC (   1) MLPS  -3.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22551.4  4WF9 G 1991 C 1961'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00              GCAU*GC (   1) MLPS  -4.14 deficit   0.19 prct   0.00 CutScore  97.95;  Ed  0, 0
ans =

    ' IL_22551.4  8CRE G 2285 C 2255'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00              GCAU*GC (   1) MLPS  -4.14 deficit   0.19 prct   0.00 CutScore  97.95;  Ed  0, 0
ans =

    ' IL_22551.4  8P9A G 2307 C 2277'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00              GCAU*GC (   1) MLPS  -4.14 deficit   0.19 prct   0.00 CutScore  97.95;  Ed  0, 0
ans =

    ' IL_22551.4  4V9F G 2005 C 1975'

 matches the original group, cWW-L-cWW-L
Better:   7 Equal:   0 Score 0.00              GUUA*UC (   1) MLPS  -6.86 deficit   2.91 prct   0.00 CutScore  69.37;  Ed  0, 0
ans =

    ' IL_22551.4  8CRE G  803 C  837'

 scores better against   7 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.16, deficit  0.00, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -4.66, deficit  0.39, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -5.10, deficit  0.07, prct   0.00; IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -5.67, deficit  0.94, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -6.15, deficit  0.58, prct   0.00; 
Better:   8 Equal:   0 Score 0.00             AUCUG*CU (   1) MLPS  -9.88 deficit   5.93 prct   0.00 CutScore  37.59;  Ed  0, 0
ans =

    ' IL_22551.4  397D A   22 U   40'

 scores better against   8 groups: IL_94967.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -6.49, deficit  1.26, prct   0.00; IL_20031.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -7.84, deficit  1.17, prct   0.00; IL_47078.3,  7 NTs, cWW-cWS-L-cWW-L                         , Ed  5, 2, MLPS -8.09, deficit  2.71, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  4, 2, MLPS -8.61, deficit  3.04, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  4, 1, MLPS -8.89, deficit  4.62, prct   0.00; 
Group 111 is from IL_26685.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_26685.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             UUGAU*GG (   1) MLPS  -3.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26685.1  3IGI U  234 G  129'

 matches the original group, cWW-L-cWW-L
Group 188 is from IL_47074.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47074.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UAGU*AG (   1) MLPS  -3.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_47074.2  4LFB U  249 G  275'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00              UAGU*AG (   1) MLPS  -3.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_47074.2  5J7L U  249 G  275'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00              AAGC*GU (   1) MLPS  -5.39 deficit   2.03 prct   0.00 CutScore  78.68;  Ed  0, 0
ans =

    ' IL_47074.2  4V9F A  602 U  555'

 matches the original group, cWW-L-cWW-L
Better:   1 Equal:   0 Score 0.00            UUUCGA*UG (   1) MLPS  -7.33 deficit   3.96 prct   0.00 CutScore  58.28;  Ed  0, 0
ans =

    ' IL_47074.2  8P9A U  318 G  346'

 scores better against   1 groups: IL_99380.1,  8 NTs, cWW-L-cWW-L-L-R                         , Ed  0, 0, MLPS -4.81, deficit  0.00, prct   0.00; 
Group 290 is from IL_70376.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70376.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UGUGUA*UG (   1) MLPS  -5.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70376.1  8CRE U  248 G  169'

 matches the original group, cWW-L-cWW-L
Group 299 is from IL_73355.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_73355.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CAAC*GG (   1) MLPS  -3.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_73355.1  8P9A C 2098 G 1948'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00              CAAC*GG (   1) MLPS  -3.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_73355.1  8CRE C 2076 G 1944'

 matches the original group, cWW-L-cWW-L
Group 314 is from IL_76709.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_76709.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              AAUC*GU (   1) MLPS  -4.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_76709.2  4V9F A 1286 U 1270'

 matches the original group, cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00              UAUC*GG (   1) MLPS  -4.88 deficit   0.44 prct   0.00 CutScore  95.36;  Ed  0, 0
ans =

    ' IL_76709.2  1KXK U    8 G   62'

 matches the original group, cWW-L-cWW-L
Better:   1 Equal:   0 Score 0.00              GACC*GC (   1) MLPS  -4.88 deficit   0.44 prct   0.00 CutScore  95.32;  Ed  0, 0
ans =

    ' IL_76709.2  8CRE G  238 C  177'

 scores better against   1 groups: IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -4.47, deficit  1.61, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              GAAG*CC (   1) MLPS  -4.98 deficit   0.54 prct   0.00 CutScore  94.27;  Ed  0, 0
ans =

    ' IL_76709.2  1MJI G   51 C   31'

 scores better against   2 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.26, deficit  0.00, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -4.17, deficit  0.24, prct   0.00; 
Group 325 is from IL_79895.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_79895.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GUCC*GC (   1) MLPS  -5.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_79895.1  8CRE G 2742 C 2760'

 matches the original group, cWW-L-cWW-L
Better:   1 Equal:   0 Score 0.00              GAUU*AC (   1) MLPS  -5.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_79895.1  4LCK G   28 C   78'

 scores better against   1 groups: IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  3, 0, MLPS -4.54, deficit  0.10, prct   0.00; 
Group 392 is from IL_94967.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_94967.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GUUUC*GC (   1) MLPS  -5.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_94967.1  6JOO G   61 C   58'

 matches the original group, cWW-L-cWW-L
Group 104 is from IL_25412.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25412.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CAUUUGG*CG (   1) MLPS  -5.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_25412.1  1NTA C    7 G  114'

 matches the original group, cWW-L-cWW-L-L
Group 105 is from IL_25463.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25463.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   4 Equal:   0 Score 0.00            CGUAU*AAG (   1) MLPS  -7.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_25463.1  8P9A C  977 G 1104'

 scores better against   4 groups: IL_61476.2,  8 NTs, cWW-tSH-L-cWW-L                         , Ed  3, 0, MLPS -5.27, deficit  0.24, prct   0.00; IL_69440.3,  8 NTs, cWW-L-R-cSH-cWW                         , Ed  3, 1, MLPS -7.19, deficit  2.26, prct   0.00; IL_47972.1,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  3, 2, MLPS -7.66, deficit  2.29, prct   0.00; IL_44325.1,  6 NTs, cWW-cWH-cWW-L                           , Ed  5, 1, MLPS -7.66, deficit  1.84, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            ACCACG*CU (   1) MLPS  -7.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_25463.1  1NTA A  105 U   19'

 matches the original group, cWW-L-cWW-L-L
Group 122 is from IL_29346.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_29346.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGGAG*UC (   1) MLPS  -4.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_29346.2  5J7L G  774 C  805'

 matches the original group, cWW-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00             GGGAG*UC (   1) MLPS  -4.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_29346.2  4LFB G  774 C  805'

 matches the original group, cWW-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00            CGAUUG*CG (   1) MLPS  -8.86 deficit   4.48 prct   0.00 CutScore  52.89;  Ed  0, 0
ans =

    ' IL_29346.2  3PDR C  163 G   22'

 matches the original group, cWW-L-cWW-L-L
Group 198 is from IL_49714.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_49714.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00           GAACUAC*GC (   1) MLPS  -4.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_49714.1  3TZR G   52 C  111'

 scores better against   1 groups: IL_88017.1,  9 NTs, cWW-L-cWW-L-L-R-L                       , Ed  0, 0, MLPS -2.63, deficit  0.00, prct   0.00; 
Group 343 is from IL_82741.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82741.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CAACG*UUG (   1) MLPS  -5.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82741.2  8CRE C 3190 G 3225'

 matches the original group, cWW-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00            CAACG*UUG (   1) MLPS  -5.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82741.2  8P9A C 3225 G 3260'

 matches the original group, cWW-L-cWW-L-L
Better:   4 Equal:   0 Score 0.00             CCCUU*AG (   1) MLPS  -8.48 deficit   2.60 prct   0.00 CutScore  74.00;  Ed  0, 0
ans =

    ' IL_82741.2  8D29 C   21 G   11'

 scores better against   4 groups: IL_20031.1,  6 NTs, cWW-L-cWW-L                             , Ed  0, 0, MLPS -6.67, deficit  0.00, prct   0.00; IL_95583.2,  5 NTs, cWW-L-cWW                               , Ed  4, 1, MLPS -7.27, deficit  3.43, prct   0.00; IL_94967.1,  6 NTs, cWW-L-cWW-L                             , Ed  6, 2, MLPS -7.59, deficit  2.35, prct   0.00; IL_07171.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -8.24, deficit  3.41, prct   0.00; 
Group 387 is from IL_92634.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_92634.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AGUUGU*AU (   1) MLPS  -3.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_92634.2  8CRE A  143 U  123'

 matches the original group, cWW-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00            AGUUGU*AU (   1) MLPS  -3.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_92634.2  8P9A A  144 U  124'

 matches the original group, cWW-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00            CAAUGU*AG (   1) MLPS  -6.23 deficit   2.26 prct   0.00 CutScore  83.83;  Ed  0, 0
ans =

    ' IL_92634.2  4V9F C  260 G  249'

 matches the original group, cWW-L-cWW-L-L
Group 153 is from IL_38186.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_38186.6
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CGUAAAG*CG (   1) MLPS  -5.12 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38186.6  4LFB C  569 G  881'

 matches the original group, cWW-L-cWW-L-L-R
Better:   0 Equal:   0 Score 1.00           CGUAAAG*CG (   1) MLPS  -5.12 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38186.6  5J7L C  569 G  881'

 matches the original group, cWW-L-cWW-L-L-R
Better:   0 Equal:   0 Score 1.00           GUUAAAA*UC (   1) MLPS  -5.12 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38186.6  8P9A G  616 C 1105'

 matches the original group, cWW-L-cWW-L-L-R
Better:   0 Equal:   0 Score 1.00           GUUAAAA*UC (   1) MLPS  -5.12 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38186.6  8CRE G  614 C 1090'

 matches the original group, cWW-L-cWW-L-L-R
Group 184 is from IL_46086.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46086.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CAACAAG*UG (   1) MLPS  -5.78 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_46086.1  9DFE C 1506 G 1482'

 matches the original group, cWW-L-cWW-L-L-R
Group 222 is from IL_55917.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_55917.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UAGUGUCCU*AG (   1) MLPS  -8.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_55917.1  4KR9 U    8 G   28'

 matches the original group, cWW-L-cWW-L-L-R
Group 408 is from IL_99380.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_99380.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UUUCGA*UG (   1) MLPS  -4.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_99380.1  8CRE U  316 G  344'

 matches the original group, cWW-L-cWW-L-L-R
Group 185 is from IL_46112.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46112.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-cWW-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00         AACAUUUUC*GU (   1) MLPS  -8.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_46112.1  4Y1M A   44 U   64'

 scores better against   1 groups: IL_33711.1,  9 NTs, cWW-cSH-cWW-L-L-R-L                     , Ed  2, 2, MLPS -8.01, deficit  0.00, prct   0.00; 
Group 214 is from IL_53596.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_53596.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-cWW-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GUGGAACCG*UC (   1) MLPS  -7.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53596.1  6PMO G  159 C  186'

 matches the original group, cWW-L-cWW-L-L-R-L
Better:   0 Equal:   0 Score 1.00         GUGGCACCG*UC (   1) MLPS  -7.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53596.1  6UFH G  125 C  162'

 matches the original group, cWW-L-cWW-L-L-R-L
Group 367 is from IL_88017.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_88017.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-cWW-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GAACUAC*GC (   1) MLPS  -2.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88017.1  7JRT G   24 C   51'

 matches the original group, cWW-L-cWW-L-L-R-L
Better:   0 Equal:   0 Score 1.00           GAACUAC*GC (   1) MLPS  -2.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88017.1  7JRT G   24 C   51'

 matches the original group, cWW-L-cWW-L-L-R-L
Better:   0 Equal:   0 Score 1.00           GAACUAC*GC (   1) MLPS  -2.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88017.1  3P59 G   52 C  111'

 matches the original group, cWW-L-cWW-L-L-R-L
Better:   0 Equal:   0 Score 1.00           GAACUAC*GC (   1) MLPS  -2.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88017.1  7JRT G   91 C  118'

 matches the original group, cWW-L-cWW-L-L-R-L
Better:   0 Equal:   0 Score 1.00           GAACUAC*GC (   1) MLPS  -2.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88017.1  7JRT G   91 C  118'

 matches the original group, cWW-L-cWW-L-L-R-L
Better:   0 Equal:   0 Score 1.00           GAACUAC*GC (   1) MLPS  -2.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88017.1  2PN3 G   52 C  111'

 matches the original group, cWW-L-cWW-L-L-R-L
Better:   0 Equal:   0 Score 1.00           GAACUAC*GC (   1) MLPS  -2.63 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88017.1  6DVK G   28 C   62'

 matches the original group, cWW-L-cWW-L-L-R-L
Group 110 is from IL_26598.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_26598.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-cWW-L-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GGCGUCCC*GC (   1) MLPS  -5.46 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26598.1  7JRS G  104 C   29'

 matches the original group, cWW-L-cWW-L-L-R-L-R
Better:   0 Equal:   0 Score 1.00          GGCGUCCC*GC (   1) MLPS  -5.46 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26598.1  7JRS G  104 C   29'

 matches the original group, cWW-L-cWW-L-L-R-L-R
Better:   0 Equal:   0 Score 1.00          AGCCUGCC*GU (   1) MLPS  -6.16 deficit   0.71 prct   0.00 CutScore  95.52;  Ed  0, 0
ans =

    ' IL_26598.1  7JRS A   39 U   94'

 matches the original group, cWW-L-cWW-L-L-R-L-R
Better:   0 Equal:   0 Score 1.00          AGCCUGCC*GU (   1) MLPS  -6.16 deficit   0.71 prct   0.00 CutScore  95.52;  Ed  0, 0
ans =

    ' IL_26598.1  7JRS A   39 U   94'

 matches the original group, cWW-L-cWW-L-L-R-L-R
Better:   0 Equal:   0 Score 1.00          GGAAACCC*GC (   1) MLPS  -8.16 deficit   2.71 prct   0.00 CutScore  82.86;  Ed  0, 0
ans =

    ' IL_26598.1  3R4F G   14 C   35'

 matches the original group, cWW-L-cWW-L-L-R-L-R
Group 114 is from IL_27393.10 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_27393.10
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-cWW-L-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CUACCCAC*GG (   1) MLPS  -5.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_27393.10  5CNR C    5 G   41'

 matches the original group, cWW-L-cWW-L-L-R-L-R
Better:   0 Equal:   0 Score 1.00          CUACCCAC*GG (   1) MLPS  -5.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_27393.10  4P97 C    5 G   41'

 matches the original group, cWW-L-cWW-L-L-R-L-R
Better:   0 Equal:   0 Score 1.00          CUCCCCAC*GG (   1) MLPS  -5.95 deficit   0.51 prct   0.00 CutScore  97.05;  Ed  0, 0
ans =

    ' IL_27393.10  4PHY C    5 G   41'

 matches the original group, cWW-L-cWW-L-L-R-L-R
Group  89 is from IL_21173.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21173.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-cWW-L-L-R-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GUGGAACCC*GC (   1) MLPS  -5.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_21173.1  7UQ6 G   30 C   50'

 matches the original group, cWW-L-cWW-L-L-R-L-R-L
Better:   0 Equal:   0 Score 1.00         GUGGAACCC*GC (   1) MLPS  -5.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_21173.1  7UZ0 G   43 C   34'

 matches the original group, cWW-L-cWW-L-L-R-L-R-L
Group 344 is from IL_82968.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82968.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-cWW-L-L-R-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CGGAGGCAC*GG (   1) MLPS  -6.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82968.1  7JRT C   11 G   57'

 matches the original group, cWW-L-cWW-L-L-R-L-R-L
Better:   0 Equal:   0 Score 1.00         CGGAGGCAC*GG (   1) MLPS  -6.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82968.1  7JRT C   11 G   57'

 matches the original group, cWW-L-cWW-L-L-R-L-R-L
Group  75 is from IL_18354.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_18354.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-cWW-L-L-R-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGAGCGCUGC*GC (   1) MLPS -10.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_18354.1  3NPQ G    7 C   32'

 matches the original group, cWW-L-cWW-L-L-R-L-R-L-R
Better:   0 Equal:   0 Score 1.00       GGAGCUAAGCU*AC (   1) MLPS -11.43 deficit   0.69 prct   0.00 CutScore  95.72;  Ed  0, 0
ans =

    ' IL_18354.1  7LYF G   73 C   50'

 matches the original group, cWW-L-cWW-L-L-R-L-R-L-R
Group  63 is from IL_15218.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_15218.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-cWW-L-L-R-L-R-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CACAGCAGAAG*CG (   1) MLPS -10.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15218.1  7QR3 C    7 G   30'

 matches the original group, cWW-L-cWW-L-L-R-L-R-L-R-L
Better:   0 Equal:   0 Score 1.00       CAUGGUCCCAG*CG (   1) MLPS -10.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15218.1  4PR6 C  107 G  131'

 matches the original group, cWW-L-cWW-L-L-R-L-R-L-R-L
Group 215 is from IL_53787.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_53787.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-cWW-L-L-R-L-R-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CUUUCUGCCAAAG*UG (   1) MLPS -10.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53787.1  3IGI C  197 G  169'

 matches the original group, cWW-L-cWW-L-L-R-L-R-L-R-L-R
Group 328 is from IL_80298.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80298.1
This group is considered to be structured ***************************
Number of NTs: 24  Signature: cWW-L-cWW-L-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CAGGGGAUUGAAAAUUCCGAGU*AUAG (   1) MLPS -17.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80298.1  4WT8 C   25 G   10'

 matches the original group, cWW-L-cWW-L-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R-L-R
Group 159 is from IL_41203.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_41203.4
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-cWW-L-L-R-cSH
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UCCCCAAG*CA (   1) MLPS  -6.68 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_41203.4  4V9F U 1101 A 1255'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Better:   0 Equal:   0 Score 1.00          UGCCGGAA*UA (   1) MLPS  -6.72 deficit   0.05 prct   0.00 CutScore  99.67;  Ed  0, 0
ans =

    ' IL_41203.4  8CRE U 1169 A 1322'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Better:   0 Equal:   0 Score 1.00          UGCCGGAA*UA (   1) MLPS  -6.72 deficit   0.05 prct   0.00 CutScore  99.67;  Ed  0, 0
ans =

    ' IL_41203.4  8P9A U 1173 A 1326'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Better:   0 Equal:   0 Score 1.00          CCCCCAAG*CG (   1) MLPS  -6.80 deficit   0.13 prct   0.00 CutScore  99.06;  Ed  0, 0
ans =

    ' IL_41203.4  9DFE C 1004 G 1151'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Better:   0 Equal:   0 Score 1.00          UCCCAAAG*CA (   1) MLPS  -6.90 deficit   0.22 prct   0.00 CutScore  98.40;  Ed  0, 0
ans =

    ' IL_41203.4  5J7L U 1004 A 1151'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Better:   0 Equal:   0 Score 1.00          UCCCUAAA*UA (   1) MLPS  -6.93 deficit   0.26 prct   0.00 CutScore  98.14;  Ed  0, 0
ans =

    ' IL_41203.4  7A0S U 1015 A 1162'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Better:   0 Equal:   0 Score 1.00          UCCCAAAA*UA (   1) MLPS  -6.94 deficit   0.27 prct   0.00 CutScore  98.07;  Ed  0, 0
ans =

    ' IL_41203.4  4WF9 U 1048 A 1195'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Better:   0 Equal:   0 Score 1.00          CGGCCAAC*GG (   1) MLPS  -7.28 deficit   0.61 prct   0.00 CutScore  95.60;  Ed  0, 0
ans =

    ' IL_41203.4  4LFB C  504 G  541'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Better:   0 Equal:   0 Score 1.00          CGGCUAAC*GG (   1) MLPS  -7.49 deficit   0.82 prct   0.00 CutScore  94.07;  Ed  0, 0
ans =

    ' IL_41203.4  5J7L C  504 G  541'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Better:   0 Equal:   0 Score 1.00          AGGGCAAG*CU (   1) MLPS  -8.53 deficit   1.86 prct   0.00 CutScore  86.57;  Ed  0, 0
ans =

    ' IL_41203.4  8CRE A  548 U  586'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Better:   0 Equal:   0 Score 1.00          AGGGCAAG*CU (   1) MLPS  -8.53 deficit   1.86 prct   0.00 CutScore  86.57;  Ed  0, 0
ans =

    ' IL_41203.4  8P9A A  550 U  588'

 matches the original group, cWW-L-cWW-L-L-R-cSH
Group  83 is from IL_19897.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_19897.3
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-cWW-L-L-tWH-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CCAAUCGUA*UG (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_19897.3  7EOG C   28 G   15'

 matches the original group, cWW-L-cWW-L-L-tWH-R-L
Better:   0 Equal:   0 Score 1.00         CCAAUCGUA*UG (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_19897.3  7SZU C    9 G   60'

 matches the original group, cWW-L-cWW-L-L-tWH-R-L
Group 258 is from IL_64048.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_64048.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-cWW-L-L-tWH-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CCGAAGCGAG*UG (   1) MLPS  -6.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_64048.1  4MGN C   37 G   69'

 matches the original group, cWW-L-cWW-L-L-tWH-R-L-R
Better:   0 Equal:   0 Score 1.00        CCGAAGCGAG*UG (   1) MLPS  -6.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_64048.1  4JRC C   37 G   69'

 matches the original group, cWW-L-cWW-L-L-tWH-R-L-R
Group 137 is from IL_32056.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_32056.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-cWW-L-L-tWH-R-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GCGUAGGAUAG*CC (   1) MLPS  -6.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_32056.1  3U4M G 2110 C 2179'

 matches the original group, cWW-L-cWW-L-L-tWH-R-L-R-L
Better:   0 Equal:   0 Score 1.00       GCGUAGGAUAG*CC (   1) MLPS  -6.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_32056.1  1MZP G    6 C   50'

 matches the original group, cWW-L-cWW-L-L-tWH-R-L-R-L
Better:   0 Equal:   0 Score 1.00       GUGCAGCAUAG*CC (   1) MLPS  -8.09 deficit   1.53 prct   0.00 CutScore  92.34;  Ed  0, 0
ans =

    ' IL_32056.1  5ML7 G 2151 C 2224'

 matches the original group, cWW-L-cWW-L-L-tWH-R-L-R-L
Group 282 is from IL_69145.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_69145.3
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-cWW-L-R-L-R-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UCCUGC*GAAA (   1) MLPS  -4.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69145.3  5FJC U   64 A   85'

 matches the original group, cWW-L-cWW-L-R-L-R-R
Better:   0 Equal:   0 Score 1.00          UCCUGC*GAAA (   1) MLPS  -4.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69145.3  4AOB U   64 A   85'

 matches the original group, cWW-L-cWW-L-R-L-R-R
Better:   0 Equal:   0 Score 1.00          UCCUGC*GAAA (   1) MLPS  -4.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69145.3  3V7E U   96 A  117'

 matches the original group, cWW-L-cWW-L-R-L-R-R
Better:   0 Equal:   0 Score 1.00          UCCAGC*GGAA (   1) MLPS  -5.93 deficit   1.69 prct   0.00 CutScore  90.60;  Ed  0, 0
ans =

    ' IL_69145.3  4KQY U   85 A  109'

 matches the original group, cWW-L-cWW-L-R-L-R-R
Group 143 is from IL_33886.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_33886.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-cWW-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CAAUGUG*CGAAG (   1) MLPS  -9.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_33886.1  4V9F C  260 G  249'

 matches the original group, cWW-L-cWW-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00        ACCACGG*CUUCU (   1) MLPS -10.95 deficit   1.03 prct   0.00 CutScore  93.83;  Ed  0, 0
ans =

    ' IL_33886.1  1NTA A  105 U   19'

 matches the original group, cWW-L-cWW-L-R-L-R-cWW
Group 241 is from IL_60448.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_60448.1
This group is considered to be structured ***************************
Number of NTs: 20  Signature: cWW-L-cWW-L-R-L-tWH-L-tHS-L-R-L-cWW-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GGAGCGCUGCAAG*CCCAGGC (   1) MLPS -10.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_60448.1  3NPQ G    7 C   32'

 matches the original group, cWW-L-cWW-L-R-L-tWH-L-tHS-L-R-L-cWW-L-R
Group  44 is from IL_10389.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_10389.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00            GCAGC*GAC (   1) MLPS  -6.91 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10389.1  4R4V G  749 C  726'

 scores better against   1 groups: IL_28788.1,  6 NTs, cWW-L-R-cWW                             , Ed  5, 3, MLPS -6.84, deficit  1.20, prct   0.00; 
Better:   0 Equal:   0 Score 1.00           CCCUUG*CAG (   1) MLPS  -8.08 deficit   1.18 prct   0.00 CutScore  89.89;  Ed  0, 0
ans =

    ' IL_10389.1  8D29 C   21 G   11'

 matches the original group, cWW-L-cWW-L-cWW
Group 281 is from IL_69000.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_69000.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGGCGC*GAC (   1) MLPS  -5.40 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69000.1  9C2K G    9 C   32'

 matches the original group, cWW-L-cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00           GGGCGC*GAC (   1) MLPS  -5.40 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69000.1  9C2K G    9 C   32'

 matches the original group, cWW-L-cWW-L-cWW-L
Group 151 is from IL_37603.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_37603.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-cWW-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CAUCUCGC*GAG (   1) MLPS  -7.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_37603.1  3SUX C   89 G    8'

 matches the original group, cWW-L-cWW-L-cWW-L-L
Group 396 is from IL_95811.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_95811.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-cWW-L-cWW-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CGCAUAAC*GCG (   1) MLPS  -5.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_95811.1  1ET4 C  211 G  230'

 matches the original group, cWW-L-cWW-L-cWW-L-R-L
Group 190 is from IL_47087.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47087.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-cWW-L-cWW-tWH-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GGAACUAC*GCC (   1) MLPS  -6.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_47087.1  3P59 G   51 C  112'

 matches the original group, cWW-L-cWW-L-cWW-tWH-L-L
Group 235 is from IL_58960.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_58960.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-cWW-L-tWW-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UAAAGAGUG*CA (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_58960.1  4M4O U   15 A   45'

 matches the original group, cWW-L-cWW-L-tWW-L-R-L
Better:   0 Equal:   0 Score 1.00         UAAAGAGUG*CA (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_58960.1  4M6D U   15 A   45'

 matches the original group, cWW-L-cWW-L-tWW-L-R-L
Better:   0 Equal:   0 Score 1.00         AAAAGCAUG*CU (   1) MLPS  -7.21 deficit   1.08 prct   0.00 CutScore  93.80;  Ed  0, 0
ans =

    ' IL_58960.1  4FRN A    6 U   76'

 matches the original group, cWW-L-cWW-L-tWW-L-R-L
Group  59 is from IL_14368.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_14368.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-L-cWW-cSH
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CUAA*UG (   1) MLPS  -2.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_14368.1  5VCI C    8 G    5'

 matches the original group, cWW-L-cWW-cSH
Better:   0 Equal:   0 Score 1.00              CUAA*UG (   1) MLPS  -2.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_14368.1  4PCJ C    8 G   28'

 matches the original group, cWW-L-cWW-cSH
Better:   0 Equal:   0 Score 1.00              CUAA*UG (   1) MLPS  -2.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_14368.1  5XTM C   41 G    6'

 matches the original group, cWW-L-cWW-cSH
Better:   0 Equal:   0 Score 1.00              CUAA*UG (   1) MLPS  -2.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_14368.1  1U6B C  147 G  163'

 matches the original group, cWW-L-cWW-cSH
Better:   0 Equal:   0 Score 1.00              CUAA*UG (   1) MLPS  -2.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_14368.1  5DCV C   45 G    6'

 matches the original group, cWW-L-cWW-cSH
Better:   1 Equal:   0 Score 0.00             GAGCA*UU (   1) MLPS -10.11 deficit   7.70 prct   0.00 CutScore  26.25;  Ed  0, 0
ans =

    ' IL_14368.1  7VTI G    5 U   31'

 scores better against   1 groups: IL_20031.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -9.98, deficit  3.31, prct   0.00; 
Group 171 is from IL_43140.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_43140.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-cWW-cWH-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UGGUUGGGUG*CG (   1) MLPS  -7.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_43140.1  7OAX U   30 G   17'

 matches the original group, cWW-L-cWW-cWH-L-L
Group 288 is from IL_70096.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70096.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UUUG*CUUAUG (   1) MLPS  -6.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70096.1  6MWN U  604 G  675'

 matches the original group, cWW-L-cWW-cWW
Group 277 is from IL_68243.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_68243.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-cWW-cWW-R-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CGCUGAC*GGUGGAG (   1) MLPS  -6.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68243.1  9DFE C  844 G  934'

 matches the original group, cWW-L-cWW-cWW-R-L-tHS-cWW
Group  41 is from IL_09908.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09908.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-tHH-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CACAAAC*GGAG (   1) MLPS  -8.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09908.1  1U6B C  197 G  184'

 matches the original group, cWW-L-tHH-L-R-L-cWW-L
Group 140 is from IL_33623.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_33623.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-tHH-L-R-L-cWW-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CACGGAAG*CUGG (   1) MLPS  -7.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_33623.1  5T83 C   69 G   89'

 matches the original group, cWW-L-tHH-L-R-L-cWW-L-R
Group 382 is from IL_91592.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_91592.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-tHH-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CACGGAG*CGG (   1) MLPS  -6.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_91592.1  7MLW C  104 G  124'

 matches the original group, cWW-L-tHH-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00          CACGGCG*CGG (   1) MLPS  -6.70 deficit   0.60 prct   0.00 CutScore  96.48;  Ed  0, 0
ans =

    ' IL_91592.1  5U3G C   60 G   80'

 matches the original group, cWW-L-tHH-L-cWW-L-L
Group 162 is from IL_41853.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_41853.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-L-tHH-L-tHS-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CAGUGAAAG*CGAG (   1) MLPS -10.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_41853.1  4V9F C 1521 G 1665'

 matches the original group, cWW-L-tHH-L-tHS-L-cWW-L-L
Group  96 is from IL_22829.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_22829.2
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-tHS-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         AAUAAUG*CUAU (   1) MLPS  -6.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22829.2  8CRE A 1879 U 2327'

 matches the original group, cWW-L-tHS-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00         AAUAAUG*CUAU (   1) MLPS  -6.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22829.2  8P9A A 1883 U 2349'

 matches the original group, cWW-L-tHS-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00         GGGGUGC*GUCC (   1) MLPS -12.65 deficit   5.78 prct   0.00 CutScore  67.26;  Ed  0, 0
ans =

    ' IL_22829.2  3NDB G  247 C  131'

 matches the original group, cWW-L-tHS-L-R-L-cWW-L
Group 132 is from IL_31558.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31558.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-tHS-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CGAAG*UGGG (   1) MLPS  -5.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31558.1  6JXM C   35 G   53'

 matches the original group, cWW-L-tHS-L-R-cWW
Group  51 is from IL_12566.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_12566.4
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-L-tHS-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GAGAAC*GAC (   1) MLPS  -3.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_12566.4  5J7L G 1651 C 2006'

 matches the original group, cWW-L-tHS-L-cWW-L
Better:   0 Equal:   0 Score 1.00           GAGAAC*GAC (   1) MLPS  -3.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_12566.4  7A0S G 1668 C 1989'

 matches the original group, cWW-L-tHS-L-cWW-L
Better:   0 Equal:   0 Score 1.00           GAGAAC*GAC (   1) MLPS  -3.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_12566.4  9DFE G 1651 C 2006'

 matches the original group, cWW-L-tHS-L-cWW-L
Better:   0 Equal:   0 Score 1.00           GCGAAC*GAC (   1) MLPS  -4.93 deficit   1.10 prct   0.00 CutScore  92.43;  Ed  0, 0
ans =

    ' IL_12566.4  4WF9 G 1695 C 2033'

 matches the original group, cWW-L-tHS-L-cWW-L
Better:   0 Equal:   0 Score 1.00          GAGCAAC*GGC (   1) MLPS  -7.24 deficit   3.41 prct   0.00 CutScore  76.48;  Ed  0, 0
ans =

    ' IL_12566.4  4V9F G 1728 C 2047'

 matches the original group, cWW-L-tHS-L-cWW-L
Group 305 is from IL_74184.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_74184.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-tHS-L-cWW-L-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CGGGAUGUG*CGG (   1) MLPS  -8.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_74184.1  4GXY C   95 G  130'

 matches the original group, cWW-L-tHS-L-cWW-L-L-L
Group 348 is from IL_84251.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_84251.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UCCG*UCCG (   1) MLPS  -6.91 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_84251.1  7EDT U    5 G   20'

 matches the original group, cWW-L-tHS-cWW
Better:   5 Equal:   0 Score 0.00           CAAG*CGAAG (   1) MLPS  -9.49 deficit   2.59 prct   0.00 CutScore  75.51;  Ed  0, 0
ans =

    ' IL_84251.1  4R4V C  637 G  623'

 scores better against   5 groups: IL_68574.4,  8 NTs, cWW-tHH-tHS-cWW                         , Ed  2, 1, MLPS -7.14, deficit  1.35, prct   0.00; IL_77691.5,  9 NTs, cWW-tSH-L-R-L-cWW                       , Ed  1, 1, MLPS -7.69, deficit  0.96, prct   0.00; IL_71598.1,  8 NTs, cWW-tSH-L-cWW-L                         , Ed  4, 0, MLPS -8.29, deficit  2.08, prct   0.00; IL_64231.5,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  3, 2, MLPS -8.89, deficit  2.21, prct   0.00; IL_48444.6,  8 NTs, cWW-L-R-cWW-cWW                         , Ed  3, 1, MLPS -9.23, deficit  1.42, prct   0.00; 
Group 269 is from IL_66663.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_66663.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-L-tHS-tSW-tWH-cWH-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  GUCUGUGAUG*UGCAUGGC (   1) MLPS -10.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_66663.1  8CRE G 1415 C 1264'

 matches the original group, cWW-L-tHS-tSW-tWH-cWH-cWW-L-cWW
Group 283 is from IL_69229.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_69229.3
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-L-tSH-L-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GCGUGAUG*CUGAC (   1) MLPS  -7.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69229.3  3NVI G   15 C    8'

 matches the original group, cWW-L-tSH-L-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00       GCGUGAUG*CUGAC (   1) MLPS  -7.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69229.3  3NMU G   24 C   17'

 matches the original group, cWW-L-tSH-L-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00       GCGUGAUG*CUGAC (   1) MLPS  -7.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69229.3  1RLG G   15 C    8'

 matches the original group, cWW-L-tSH-L-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00       UUGUGAUG*CUGAA (   1) MLPS  -8.10 deficit   0.24 prct   0.00 CutScore  98.78;  Ed  0, 0
ans =

    ' IL_69229.3  5GIP U    8 A   34'

 matches the original group, cWW-L-tSH-L-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00       UUGUGAUG*CUGAA (   1) MLPS  -8.10 deficit   0.24 prct   0.00 CutScore  98.78;  Ed  0, 0
ans =

    ' IL_69229.3  5GIP U    8 A   34'

 matches the original group, cWW-L-tSH-L-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00       CAAUGAUG*UUGAG (   1) MLPS -10.01 deficit   2.15 prct   0.00 CutScore  89.16;  Ed  0, 0
ans =

    ' IL_69229.3  3Q3Z C   16 G   58'

 matches the original group, cWW-L-tSH-L-tHS-cWW-cWW
Better:   2 Equal:   0 Score 0.00       CGUUGAAA*UGGAG (   1) MLPS -11.27 deficit   3.40 prct   0.00 CutScore  82.81;  Ed  0, 0
ans =

    ' IL_69229.3  7A0S C 1598 G 1430'

 scores better against   2 groups: IL_01488.3, 12 NTs, cWW-tSS-tSH-L-R-tHS-L-cWW               , Ed  3, 2, MLPS -8.24, deficit  1.85, prct   0.00; IL_70923.9, 12 NTs, cWW-tSS-tSH-L-tHS-tHS-cWW               , Ed  1, 0, MLPS -8.33, deficit  2.84, prct   0.00; 
Better:   1 Equal:   0 Score 0.00      CGUUUGACG*CCGAG (   1) MLPS -12.86 deficit   5.00 prct   0.00 CutScore  74.78;  Ed  0, 0
ans =

    ' IL_69229.3  6DVK C   68 G   22'

 scores better against   1 groups: IL_94910.1, 12 NTs, cWW-tSS-tSH-L-R-R-L-cWW-L               , Ed  1, 0, MLPS -8.06, deficit  0.90, prct   0.00; 
Group 395 is from IL_95727.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_95727.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-L-tSH-L-tHW-tHS-R-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CGCAGAUAC*GAGUAG (   1) MLPS  -9.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_95727.1  4LFB C  699 G  688'

 matches the original group, cWW-L-tSH-L-tHW-tHS-R-cWW-L
Group 369 is from IL_88082.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_88082.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-L-tSS-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GAUUAAG*CGC (   1) MLPS  -6.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88082.1  8P9A G   42 C  433'

 matches the original group, cWW-L-tSS-L-cWW-L
Better:   0 Equal:   0 Score 1.00          GAUUAAG*CGC (   1) MLPS  -6.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88082.1  8CRE G   42 C  431'

 matches the original group, cWW-L-tSS-L-cWW-L
Group 316 is from IL_77045.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_77045.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-L-tSW-L-tHW-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       AUAUGAGG*UAAAU (   1) MLPS  -7.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77045.1  3IGI A  149 U  225'

 matches the original group, cWW-L-tSW-L-tHW-cWW-L
Group 261 is from IL_64842.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_64842.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-L-tWH-L-cWW-L-cSH
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CACUACAC*GAG (   1) MLPS  -6.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_64842.1  5ML7 C 2170 G 2204'

 matches the original group, cWW-L-tWH-L-cWW-L-cSH
Group 324 is from IL_79846.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_79846.1
This group is considered to be structured ***************************
Number of NTs: 19  Signature: cWW-R-L-L-tWH-cWW-L-L-L-R-L-R-cSH-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 UAGUAGUGCAACCGAC*GAA (   1) MLPS -11.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_79846.1  3Q3Z U   60 A   14'

 matches the original group, cWW-R-L-L-tWH-cWW-L-L-L-R-L-R-cSH-L-L
Group 117 is from IL_28304.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_28304.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-R-L-R-L-R-L-R-L-L-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  AUAAGGAUUG*CUUGAUUU (   1) MLPS -10.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28304.1  8P9A A 1224 U 1259'

 matches the original group, cWW-R-L-R-L-R-L-R-L-L-L-cWW-cWW
Group  62 is from IL_15107.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_15107.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-R-L-R-L-R-L-R-L-R-L-R-L-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00 CCCUUGGCAGC*GAUACCAG (   1) MLPS -13.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_15107.1  8D29 C   21 G   11'

 scores better against   1 groups: IL_29357.1, 18 NTs, cWW-L-R-L-R-cWH-tHW-cSH-cWW-L-L-cWW-R-R , Ed  0, 0, MLPS -7.92, deficit  0.00, prct   0.00; 
Group 293 is from IL_70670.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70670.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-R-L-R-L-R-L-R-L-R-L-R-tWH-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  GAAGAGUAU*AGAAGGCAC (   1) MLPS -12.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70670.1  4LCK G   15 C   91'

 matches the original group, cWW-R-L-R-L-R-L-R-L-R-L-R-tWH-L-R-L
Group 388 is from IL_93889.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_93889.1
This group is considered to be structured ***************************
Number of NTs: 21  Signature: cWW-R-tSH-L-cSH-L-L-R-L-R-L-R-L-R-L-R-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 UGAAACGGCAG*UCAAUAGUAG (   1) MLPS -11.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_93889.1  4MGN U   81 G   23'

 matches the original group, cWW-R-tSH-L-cSH-L-L-R-L-R-L-R-L-R-L-R-L-L
Group 287 is from IL_69986.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_69986.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-cHW-L-R-L-R-cWH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UGAUGA*UGAUGA (   1) MLPS  -6.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69986.1  3D0M U    7 A   12'

 matches the original group, cWW-cHW-L-R-L-R-cWH-cWW
Group  49 is from IL_11399.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_11399.2
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cHW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           AGGAC*GGGU (   1) MLPS  -4.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_11399.2  9J6P A   16 U    9'

 matches the original group, cWW-cHW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           AGGAC*GGGU (   1) MLPS  -4.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_11399.2  9J6P A   16 U    9'

 matches the original group, cWW-cHW-L-R-L-cWW
Better:   4 Equal:   0 Score 0.00           AAAAG*CGCU (   1) MLPS  -7.85 deficit   3.14 prct   0.00 CutScore  75.97;  Ed  0, 0
ans =

    ' IL_11399.2  8CRE A 1740 U 1634'

 scores better against   4 groups: IL_62012.1,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  0, 0, MLPS -6.38, deficit  0.00, prct   0.00; IL_51479.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -6.99, deficit  0.00, prct   0.00; IL_64231.5,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  0, 0, MLPS -7.09, deficit  0.41, prct   0.00; IL_83150.2,  7 NTs, cWW-tHH-cWW-L-L                         , Ed  3, 2, MLPS -7.13, deficit  1.28, prct   0.00; 
Group 326 is from IL_80209.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80209.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cHW-L-cWW-L-L-R-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UGAUUAGCGAC*GGA (   1) MLPS  -9.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80209.1  4LCK U   37 A   71'

 matches the original group, cWW-cHW-L-cWW-L-L-R-L-R-L
Group 340 is from IL_82426.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82426.6
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cHW-R-L-cHW-cHW-cHW-L-cWW-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    AGUAGAGUGUG*CGGGU (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82426.6  4TS2 A   64 U   32'

 matches the original group, cWW-cHW-R-L-cHW-cHW-cHW-L-cWW-R
Better:   0 Equal:   0 Score 1.00    AGUAGAGUGUG*CGGGU (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82426.6  7L0Z A   45 U   22'

 matches the original group, cWW-cHW-R-L-cHW-cHW-cHW-L-cWW-R
Better:   0 Equal:   0 Score 1.00    AGUAGAGUGUG*CGGGU (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82426.6  8K7W A   34 U   13'

 matches the original group, cWW-cHW-R-L-cHW-cHW-cHW-L-cWW-R
Better:   0 Equal:   0 Score 1.00    AGUAGAGUGUG*CGGGU (   1) MLPS  -5.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82426.6  4KZD A   53 U   29'

 matches the original group, cWW-cHW-R-L-cHW-cHW-cHW-L-cWW-R
Better:   0 Equal:   0 Score 1.00    AGUAGUGUGUG*CGGGU (   1) MLPS  -6.33 deficit   0.59 prct   0.00 CutScore  97.29;  Ed  0, 0
ans =

    ' IL_82426.6  8K85 A   40 U   14'

 matches the original group, cWW-cHW-R-L-cHW-cHW-cHW-L-cWW-R
Better:   0 Equal:   0 Score 1.00    AGUAGUGUGUG*CGGGU (   1) MLPS  -6.33 deficit   0.59 prct   0.00 CutScore  97.29;  Ed  0, 0
ans =

    ' IL_82426.6  8K85 A   40 U   14'

 matches the original group, cWW-cHW-R-L-cHW-cHW-cHW-L-cWW-R
Group 262 is from IL_64858.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_64858.3
This group is considered to be structured ***************************
Number of NTs: 22  Signature: cWW-cHW-cWH-R-L-cWH-cHW-cHW-cWH-cWH-cHW-L-cWW-L-R-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 AGUAGAGUGUGGGC*GACGGUCGGGU (   1) MLPS  -9.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_64858.3  8K7W A   34 U   13'

 matches the original group, cWW-cHW-cWH-R-L-cWH-cHW-cHW-cWH-cWH-cHW-L-cWW-L-R-cWW-L-cWW
Better:   0 Equal:   0 Score 1.00 AGUAGAGUGUGAGC*GAAGGACGGGU (   1) MLPS  -9.31 deficit   0.13 prct   0.00 CutScore  99.50;  Ed  0, 0
ans =

    ' IL_64858.3  4TS2 A   64 U   32'

 matches the original group, cWW-cHW-cWH-R-L-cWH-cHW-cHW-cWH-cWH-cHW-L-cWW-L-R-cWW-L-cWW
Better:   0 Equal:   0 Score 1.00 AGUAGAGUGUGAGC*GAAGGACGGGU (   1) MLPS  -9.31 deficit   0.13 prct   0.00 CutScore  99.50;  Ed  0, 0
ans =

    ' IL_64858.3  4KZD A   53 U   29'

 matches the original group, cWW-cHW-cWH-R-L-cWH-cHW-cHW-cWH-cWH-cHW-L-cWW-L-R-cWW-L-cWW
Better:   0 Equal:   0 Score 1.00 AGUAGUGUGUGGGC*GACGGUCGGGU (   1) MLPS  -9.77 deficit   0.59 prct   0.00 CutScore  97.65;  Ed  0, 0
ans =

    ' IL_64858.3  8K85 A   40 U   14'

 matches the original group, cWW-cHW-cWH-R-L-cWH-cHW-cHW-cWH-cWH-cHW-L-cWW-L-R-cWW-L-cWW
Better:   0 Equal:   0 Score 1.00 AGUAGUGUGUGGGC*GACGGUCGGGU (   1) MLPS  -9.77 deficit   0.59 prct   0.00 CutScore  97.65;  Ed  0, 0
ans =

    ' IL_64858.3  8K85 A   40 U   14'

 matches the original group, cWW-cHW-cWH-R-L-cWH-cHW-cHW-cWH-cWH-cHW-L-cWW-L-R-cWW-L-cWW
Better:   0 Equal:   0 Score 1.00 AGUAGAGUGUGGGC*GAGGGUCGGGU (   1) MLPS -10.79 deficit   1.61 prct   0.00 CutScore  93.56;  Ed  0, 0
ans =

    ' IL_64858.3  7L0Z A   45 U   22'

 matches the original group, cWW-cHW-cWH-R-L-cWH-cHW-cHW-cWH-cWH-cHW-L-cWW-L-R-cWW-L-cWW
Group  43 is from IL_10167.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_10167.6
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3R1C C    5 G    4'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3R1C C    2 G    7'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3SJ2 C    7 G   15'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3R1C C    2 G    7'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3SJ2 C   10 G   12'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3SJ2 C    7 G   15'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3R1C C    5 G    4'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3R1D C    2 G   10'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  4KQ0 C    9 G   11'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  4E5C C    9 G   11'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  4KQ0 C    3 G   17'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  4KQ0 C    3 G   17'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3R1D C    2 G   10'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  4KQ0 C    6 G   14'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  4KQ0 C    6 G   14'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3R1D C    5 G    7'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  6IA2 C    9 G   11'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CGG (   1) MLPS  -2.98 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10167.6  3R1E C    2 G    7'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGC*GGG (   1) MLPS  -3.23 deficit   0.26 prct   0.00 CutScore  97.31;  Ed  0, 0
ans =

    ' IL_10167.6  5J7L C  176 G  146'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              CGC*GGG (   1) MLPS  -3.23 deficit   0.26 prct   0.00 CutScore  97.31;  Ed  0, 0
ans =

    ' IL_10167.6  4WF9 C 1277 G 1245'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGG*CGA (   1) MLPS  -3.46 deficit   0.48 prct   0.00 CutScore  94.93;  Ed  0, 0
ans =

    ' IL_10167.6  8P9A U 1290 A 1325'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              GGC*GGC (   1) MLPS  -3.62 deficit   0.64 prct   0.00 CutScore  93.22;  Ed  0, 0
ans =

    ' IL_10167.6  4KTG G  209 C  211'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              GGC*GGC (   1) MLPS  -3.62 deficit   0.64 prct   0.00 CutScore  93.22;  Ed  0, 0
ans =

    ' IL_10167.6  4KTG G  203 C  217'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              GGC*GGC (   1) MLPS  -3.62 deficit   0.64 prct   0.00 CutScore  93.22;  Ed  0, 0
ans =

    ' IL_10167.6  4KTG G  203 C  217'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              GGC*GGC (   1) MLPS  -3.62 deficit   0.64 prct   0.00 CutScore  93.22;  Ed  0, 0
ans =

    ' IL_10167.6  4KTG G  212 C  208'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              GGC*GGC (   1) MLPS  -3.62 deficit   0.64 prct   0.00 CutScore  93.22;  Ed  0, 0
ans =

    ' IL_10167.6  4KTG G  212 C  208'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGC*GGA (   1) MLPS  -3.71 deficit   0.74 prct   0.00 CutScore  92.24;  Ed  0, 0
ans =

    ' IL_10167.6  5F5F U    5 A   16'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGC*GGA (   1) MLPS  -3.71 deficit   0.74 prct   0.00 CutScore  92.24;  Ed  0, 0
ans =

    ' IL_10167.6  5F5F U    5 A   16'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGC*GGA (   1) MLPS  -3.71 deficit   0.74 prct   0.00 CutScore  92.24;  Ed  0, 0
ans =

    ' IL_10167.6  7QQX U   12 A    9'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              GGU*AGC (   1) MLPS  -3.90 deficit   0.92 prct   0.00 CutScore  90.34;  Ed  0, 0
ans =

    ' IL_10167.6  3W3S G  47A C  47P'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGA*UGA (   1) MLPS  -3.92 deficit   0.94 prct   0.00 CutScore  90.09;  Ed  0, 0
ans =

    ' IL_10167.6  3CZW U    7 A   12'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGA*UGA (   1) MLPS  -3.92 deficit   0.94 prct   0.00 CutScore  90.09;  Ed  0, 0
ans =

    ' IL_10167.6  2R1S U   19 A    8'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGA*UGA (   1) MLPS  -3.92 deficit   0.94 prct   0.00 CutScore  90.09;  Ed  0, 0
ans =

    ' IL_10167.6  3D0M U    7 A   12'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGA*UGA (   1) MLPS  -3.92 deficit   0.94 prct   0.00 CutScore  90.09;  Ed  0, 0
ans =

    ' IL_10167.6  6RA4 U  403 A  405'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGG*UGG (   1) MLPS  -5.48 deficit   2.50 prct   0.00 CutScore  73.66;  Ed  0, 0
ans =

    ' IL_10167.6  406D U    8 G   27'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGG*UGG (   1) MLPS  -5.48 deficit   2.50 prct   0.00 CutScore  73.66;  Ed  0, 0
ans =

    ' IL_10167.6  406D U   25 G   10'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGG*UGG (   1) MLPS  -5.48 deficit   2.50 prct   0.00 CutScore  73.66;  Ed  0, 0
ans =

    ' IL_10167.6  406D U   25 G   10'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGG*UGG (   1) MLPS  -5.48 deficit   2.50 prct   0.00 CutScore  73.66;  Ed  0, 0
ans =

    ' IL_10167.6  406D U   25 G   10'

 matches the original group, cWW-cHW-cWW
Better:   0 Equal:   0 Score 1.00              UGG*UGG (   1) MLPS  -5.48 deficit   2.50 prct   0.00 CutScore  73.66;  Ed  0, 0
ans =

    ' IL_10167.6  8AMI U    4 G    6'

 matches the original group, cWW-cHW-cWW
Better:   1 Equal:   0 Score 0.00              GGA*UAC (   1) MLPS  -5.57 deficit   2.59 prct   0.00 CutScore  72.76;  Ed  0, 0
ans =

    ' IL_10167.6  8P9A G  389 C  408'

 scores better against   1 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 0, MLPS -5.22, deficit  1.24, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GGA*UAC (   1) MLPS  -5.57 deficit   2.59 prct   0.00 CutScore  72.76;  Ed  0, 0
ans =

    ' IL_10167.6  8CRE G  387 C  406'

 scores better against   1 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 0, MLPS -5.22, deficit  1.24, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              AGU*AAU (   1) MLPS  -6.01 deficit   3.03 prct   0.00 CutScore  68.12;  Ed  0, 0
ans =

    ' IL_10167.6  2H1M A   21 U   12'

 scores better against   3 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 0, MLPS -5.39, deficit  1.42, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -5.58, deficit -0.40, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.84, deficit  2.08, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              AGU*AAU (   1) MLPS  -6.01 deficit   3.03 prct   0.00 CutScore  68.12;  Ed  0, 0
ans =

    ' IL_10167.6  2H1M A    5 U   28'

 scores better against   3 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 0, MLPS -5.39, deficit  1.42, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -5.58, deficit -0.40, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.84, deficit  2.08, prct   0.00; 
Better:   6 Equal:   0 Score 0.00              CAG*CAG (   1) MLPS  -6.24 deficit   3.26 prct   0.00 CutScore  65.67;  Ed  0, 0
ans =

    ' IL_10167.6  4J50 C   13 G    9'

 scores better against   6 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.88, deficit  0.05, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  0, 0, MLPS -5.12, deficit  0.66, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.24, deficit  1.48, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 1, MLPS -5.51, deficit -0.51, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 1, MLPS -5.88, deficit  1.70, prct   0.00; 
Better:   6 Equal:   0 Score 0.00              CAG*CAG (   1) MLPS  -6.24 deficit   3.26 prct   0.00 CutScore  65.67;  Ed  0, 0
ans =

    ' IL_10167.6  4J50 C   13 G    9'

 scores better against   6 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.88, deficit  0.05, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  0, 0, MLPS -5.12, deficit  0.66, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.24, deficit  1.48, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 1, MLPS -5.51, deficit -0.51, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 1, MLPS -5.88, deficit  1.70, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CAG*UGG (   1) MLPS  -6.71 deficit   3.73 prct   0.00 CutScore  60.75;  Ed  0, 0
ans =

    ' IL_10167.6  4WF9 C  110 G    5'

 scores better against   1 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 0, MLPS -5.61, deficit  1.64, prct   0.00; 
Better:   7 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -7.04 deficit   4.06 prct   0.00 CutScore  57.26;  Ed  0, 0
ans =

    ' IL_10167.6  8AF0 G   34 C   36'

 scores better against   7 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.14, deficit  0.38, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -5.14, deficit  0.00, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  4, 0, MLPS -5.23, deficit  0.72, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.58, deficit  2.12, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              CAG*UAG (   1) MLPS  -7.36 deficit   4.38 prct   0.00 CutScore  53.88;  Ed  0, 0
ans =

    ' IL_10167.6  8P9A C 1711 G 1690'

 scores better against   3 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -6.18, deficit  1.34, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -6.56, deficit  0.59, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  1, 1, MLPS -6.70, deficit  2.52, prct   0.00; 
Better:   9 Equal:   0 Score 0.00              CUU*ACG (   1) MLPS  -7.47 deficit   4.50 prct   0.00 CutScore  52.68;  Ed  0, 0
ans =

    ' IL_10167.6  7MLW C   71 G   94'

 scores better against   9 groups: IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.34, deficit  1.58, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 0, MLPS -6.07, deficit  0.94, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.08, deficit  0.11, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.30, deficit  0.29, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -6.37, deficit  3.57, prct   0.00; 
Better:   9 Equal:   0 Score 0.00             GUUU*GAC (   1) MLPS -13.71 deficit  10.73 prct   0.00 CutScore  -0.00;  Ed  0, 0
ans =

    ' IL_10167.6  8CRE G  942 C  855'

 scores better against   9 groups: IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  4, 1, MLPS -8.02, deficit  2.31, prct   0.00; IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 1, MLPS -9.03, deficit  4.19, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -9.12, deficit  4.21, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -9.36, deficit  2.36, prct   0.00; IL_51387.2,  7 NTs, cWW-cSH-cWW-cWW                         , Ed  3, 1, MLPS -9.50, deficit  4.56, prct   0.00; 
Better:  18 Equal:   0 Score 0.00             GAU*AAUC (   1) MLPS -11.85 deficit   8.87 prct   0.00 CutScore   6.62;  Ed  0, 0
ans =

    ' IL_10167.6  8CRE G  285 C  266'

 scores better against  18 groups: IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  3, 1, MLPS -5.93, deficit  0.22, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -6.72, deficit  1.80, prct   0.00; IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  4, 1, MLPS -6.94, deficit  1.32, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -6.94, deficit -0.10, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  5, 1, MLPS -7.04, deficit  1.02, prct   0.00; 
Group 275 is from IL_67780.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_67780.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cSH-L-R-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GUAGG*CACAC (   1) MLPS  -6.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67780.1  4WF9 G 1476 C 1608'

 matches the original group, cWW-cSH-L-R-L-L-R-L
Group 127 is from IL_30730.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_30730.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cSH-L-R-L-cWW-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UUCAACUCG*CUA (   1) MLPS  -5.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_30730.1  7WIE U   17 A   45'

 matches the original group, cWW-cSH-L-R-L-cWW-L-R
Better:   0 Equal:   0 Score 1.00        UUCAACUCG*CUA (   1) MLPS  -5.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_30730.1  8XZL U   13 A   42'

 matches the original group, cWW-cSH-L-R-L-cWW-L-R
Group 323 is from IL_78800.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_78800.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cSH-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UUCU*AAUA (   1) MLPS  -4.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_78800.1  8CRE U 1363 A 1333'

 matches the original group, cWW-cSH-L-cWW
Better:   0 Equal:   0 Score 1.00            UUCU*AAUA (   1) MLPS  -4.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_78800.1  8P9A U 1377 A 1348'

 matches the original group, cWW-cSH-L-cWW
Group 112 is from IL_26728.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_26728.3
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cSH-R-cSH-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UGUCG*CUGG (   1) MLPS  -5.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26728.3  7EOG U   40 G   10'

 matches the original group, cWW-cSH-R-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00           UGUCG*CUGG (   1) MLPS  -5.15 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26728.3  7SZU U   21 G   55'

 matches the original group, cWW-cSH-R-cSH-cWW-cWW
Group 157 is from IL_38862.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_38862.4
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cSH-R-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGUAG*CGAAG (   1) MLPS  -6.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38862.4  9DFE U  858 G  919'

 matches the original group, cWW-cSH-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGUAG*CGAAG (   1) MLPS  -6.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38862.4  7A0S U  871 G  931'

 matches the original group, cWW-cSH-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          GGUAG*CAAAC (   1) MLPS  -6.83 deficit   0.80 prct   0.00 CutScore  92.84;  Ed  0, 0
ans =

    ' IL_38862.4  4V9F G  952 C 1015'

 matches the original group, cWW-cSH-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGUAU*AAAAG (   1) MLPS  -6.94 deficit   0.91 prct   0.00 CutScore  91.91;  Ed  0, 0
ans =

    ' IL_38862.4  2QWY C   16 G   50'

 matches the original group, cWW-cSH-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGUAG*UGAGG (   1) MLPS  -7.01 deficit   0.97 prct   0.00 CutScore  91.29;  Ed  0, 0
ans =

    ' IL_38862.4  5J7L U 1474 G 1517'

 matches the original group, cWW-cSH-R-tWH-tHS-cWW
Group 231 is from IL_58103.11 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_58103.11
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cSH-cWS-L-tSW-R-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          ACCCC*GAACU (   1) MLPS  -2.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_58103.11  5NS3 A   34 U   48'

 matches the original group, cWW-cSH-cWS-L-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          ACCCC*GAACU (   1) MLPS  -2.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_58103.11  5J7L A   34 U   48'

 matches the original group, cWW-cSH-cWS-L-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          ACCCC*GAACU (   1) MLPS  -2.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_58103.11  7A0S A   36 U   50'

 matches the original group, cWW-cSH-cWS-L-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          ACCCC*GAACU (   1) MLPS  -2.77 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_58103.11  1MJI A   34 U   48'

 matches the original group, cWW-cSH-cWS-L-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UUCCC*GAACA (   1) MLPS  -3.18 deficit   0.41 prct   0.00 CutScore  97.49;  Ed  0, 0
ans =

    ' IL_58103.11  9DFE U   34 A   48'

 matches the original group, cWW-cSH-cWS-L-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UUCCC*GAACA (   1) MLPS  -3.18 deficit   0.41 prct   0.00 CutScore  97.49;  Ed  0, 0
ans =

    ' IL_58103.11  4WF9 U   32 A   46'

 matches the original group, cWW-cSH-cWS-L-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UCCCC*GAUCA (   1) MLPS  -3.94 deficit   1.17 prct   0.00 CutScore  92.76;  Ed  0, 0
ans =

    ' IL_58103.11  8OI5 U   32 A   45'

 matches the original group, cWW-cSH-cWS-L-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UACCC*GAACA (   1) MLPS  -4.02 deficit   1.25 prct   0.00 CutScore  92.26;  Ed  0, 0
ans =

    ' IL_58103.11  4V9F U   33 A   47'

 matches the original group, cWW-cSH-cWS-L-tSW-R-R-cWW
Better:   0 Equal:   0 Score 1.00          UUCCC*GAUCA (   1) MLPS  -4.39 deficit   1.62 prct   0.00 CutScore  89.97;  Ed  0, 0
ans =

    ' IL_58103.11  8P9A U   32 A   45'

 matches the original group, cWW-cSH-cWS-L-tSW-R-R-cWW
Group 266 is from IL_65718.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_65718.4
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cSH-cWS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GUAAC*GCCC (   1) MLPS  -5.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65718.4  8P9A G 1760 C 1641'

 matches the original group, cWW-cSH-cWS-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GUAAC*GCCC (   1) MLPS  -5.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65718.4  8CRE G 1747 C 1628'

 matches the original group, cWW-cSH-cWS-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GUAAC*GCCC (   1) MLPS  -5.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65718.4  5J7L G 1497 C 1404'

 matches the original group, cWW-cSH-cWS-cWW-cWW
Better:   0 Equal:   0 Score 1.00           GUAAC*GCCC (   1) MLPS  -5.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65718.4  4LFB G 1497 C 1404'

 matches the original group, cWW-cSH-cWS-cWW-cWW
Group 194 is from IL_48076.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_48076.6
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   2 Equal:   0 Score 0.00               CAC*GG (   1) MLPS  -3.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_48076.6  9DFE C 2496 G 2455'

 scores better against   2 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -2.74, deficit  0.00, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.96, deficit  0.70, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CAC*GG (   1) MLPS  -3.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_48076.6  5J7L C 2496 G 2455'

 scores better against   2 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -2.74, deficit  0.00, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.96, deficit  0.70, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CAC*GG (   1) MLPS  -3.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_48076.6  7A0S C 2475 G 2434'

 scores better against   2 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -2.74, deficit  0.00, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.96, deficit  0.70, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CAC*GG (   1) MLPS  -3.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_48076.6  4WF9 C 2523 G 2482'

 scores better against   2 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -2.74, deficit  0.00, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.96, deficit  0.70, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CAC*GG (   1) MLPS  -3.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_48076.6  7EOG C    5 G   45'

 scores better against   2 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -2.74, deficit  0.00, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.96, deficit  0.70, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               UAC*GG (   1) MLPS  -3.68 deficit   0.35 prct   0.00 CutScore  96.27;  Ed  0, 0
ans =

    ' IL_48076.6  7A0S U 2380 G 2394'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               UAC*GG (   1) MLPS  -3.68 deficit   0.35 prct   0.00 CutScore  96.27;  Ed  0, 0
ans =

    ' IL_48076.6  1XJR U   37 G   14'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               UAC*GG (   1) MLPS  -3.68 deficit   0.35 prct   0.00 CutScore  96.27;  Ed  0, 0
ans =

    ' IL_48076.6  9DFE U 363E G 272E'

 matches the original group, cWW-cSH-cWW
Better:   2 Equal:   0 Score 0.00               CAA*UG (   1) MLPS  -3.70 deficit   0.38 prct   0.00 CutScore  95.99;  Ed  0, 0
ans =

    ' IL_48076.6  4OQU C   42 G   30'

 scores better against   2 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.21, deficit  0.47, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.63, deficit  1.36, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CAA*UG (   1) MLPS  -3.70 deficit   0.38 prct   0.00 CutScore  95.99;  Ed  0, 0
ans =

    ' IL_48076.6  5J7L C 2050 G 2618'

 scores better against   2 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.21, deficit  0.47, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.63, deficit  1.36, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CAA*UG (   1) MLPS  -3.70 deficit   0.38 prct   0.00 CutScore  95.99;  Ed  0, 0
ans =

    ' IL_48076.6  1S03 C   34 G   17'

 scores better against   2 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.21, deficit  0.47, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.63, deficit  1.36, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CAA*UG (   1) MLPS  -3.70 deficit   0.38 prct   0.00 CutScore  95.99;  Ed  0, 0
ans =

    ' IL_48076.6  1S03 C   34 G   17'

 scores better against   2 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.21, deficit  0.47, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.63, deficit  1.36, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAC*GC (   1) MLPS  -3.73 deficit   0.40 prct   0.00 CutScore  95.75;  Ed  0, 0
ans =

    ' IL_48076.6  4WF9 G  783 C  803'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.61, deficit  0.35, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               GAC*GC (   1) MLPS  -3.73 deficit   0.40 prct   0.00 CutScore  95.75;  Ed  0, 0
ans =

    ' IL_48076.6  5J7L G  738 C  758'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.61, deficit  0.35, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CCC*GG (   1) MLPS  -3.78 deficit   0.45 prct   0.00 CutScore  95.24;  Ed  0, 0
ans =

    ' IL_48076.6  1G1X C  747 G  658'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.24, deficit  0.07, prct   0.00; IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.52, deficit  0.98, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CCC*GG (   1) MLPS  -3.78 deficit   0.45 prct   0.00 CutScore  95.24;  Ed  0, 0
ans =

    ' IL_48076.6  1G1X C  747 G  658'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.24, deficit  0.07, prct   0.00; IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.52, deficit  0.98, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CCC*GG (   1) MLPS  -3.78 deficit   0.45 prct   0.00 CutScore  95.24;  Ed  0, 0
ans =

    ' IL_48076.6  4LFB C  747 G  658'

 scores better against   2 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.24, deficit  0.07, prct   0.00; IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.52, deficit  0.98, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CUC*GG (   1) MLPS  -3.82 deficit   0.50 prct   0.00 CutScore  94.74;  Ed  0, 0
ans =

    ' IL_48076.6  3OXE C   68 G   36'

 scores better against   2 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.33, deficit  1.18, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -3.67, deficit  0.93, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               UAC*GA (   1) MLPS  -3.85 deficit   0.53 prct   0.00 CutScore  94.41;  Ed  0, 0
ans =

    ' IL_48076.6  4V9F U 2531 A 2490'

 scores better against   2 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.30, deficit  1.03, prct   0.00; IL_33761.2,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.79, deficit -0.01, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAA*UG (   1) MLPS  -4.06 deficit   0.73 prct   0.00 CutScore  92.26;  Ed  0, 0
ans =

    ' IL_48076.6  1I6U U    9 G   29'

 scores better against   1 groups: IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.84, deficit  0.68, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UAA*UG (   1) MLPS  -4.06 deficit   0.73 prct   0.00 CutScore  92.26;  Ed  0, 0
ans =

    ' IL_48076.6  5J7L U  594 G  645'

 scores better against   1 groups: IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.84, deficit  0.68, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               UCC*GG (   1) MLPS  -4.13 deficit   0.81 prct   0.00 CutScore  91.51;  Ed  0, 0
ans =

    ' IL_48076.6  9DFE U 2401 G 2415'

 matches the original group, cWW-cSH-cWW
Better:   1 Equal:   0 Score 0.00               UUC*GG (   1) MLPS  -4.18 deficit   0.85 prct   0.00 CutScore  91.01;  Ed  0, 0
ans =

    ' IL_48076.6  8P9A U 2865 G 2824'

 scores better against   1 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.84, deficit  1.69, prct   0.00; 
Better:   1 Equal:   0 Score 0.00               UUA*UG (   1) MLPS  -4.48 deficit   1.16 prct   0.00 CutScore  87.82;  Ed  0, 0
ans =

    ' IL_48076.6  4WF9 U 2484 G 2521'

 scores better against   1 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.35, deficit  2.20, prct   0.00; 
Better:   3 Equal:   0 Score 0.00               GUA*UC (   1) MLPS  -4.53 deficit   1.21 prct   0.00 CutScore  87.31;  Ed  0, 0
ans =

    ' IL_48076.6  3NKB G   55 C   48'

 scores better against   3 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.79, deficit  0.64, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.93, deficit  0.70, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -4.09, deficit  0.54, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               GCA*UC (   1) MLPS  -4.56 deficit   1.23 prct   0.00 CutScore  87.02;  Ed  0, 0
ans =

    ' IL_48076.6  9FN3 G   33 C   13'

 scores better against   2 groups: IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -2.91, deficit  0.37, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.44, deficit  1.01, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               GCA*UC (   1) MLPS  -4.56 deficit   1.23 prct   0.00 CutScore  87.02;  Ed  0, 0
ans =

    ' IL_48076.6  9FN3 G   33 C   13'

 scores better against   2 groups: IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -2.91, deficit  0.37, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.44, deficit  1.01, prct   0.00; 
Better:   6 Equal:   0 Score 0.00               CAG*CG (   1) MLPS  -4.73 deficit   1.40 prct   0.00 CutScore  85.21;  Ed  0, 0
ans =

    ' IL_48076.6  7A0S C 2033 G 2597'

 scores better against   6 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.62, deficit  0.35, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.03, deficit  0.29, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.39, deficit -0.04, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.48, deficit  0.26, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.55, deficit  0.00, prct   0.00; 
Better:   6 Equal:   0 Score 0.00               CAG*CG (   1) MLPS  -4.73 deficit   1.40 prct   0.00 CutScore  85.21;  Ed  0, 0
ans =

    ' IL_48076.6  9DFE C 2050 G 2618'

 scores better against   6 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.62, deficit  0.35, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.03, deficit  0.29, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.39, deficit -0.04, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.48, deficit  0.26, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.55, deficit  0.00, prct   0.00; 
Better:   6 Equal:   0 Score 0.00               CAG*CG (   1) MLPS  -4.73 deficit   1.40 prct   0.00 CutScore  85.21;  Ed  0, 0
ans =

    ' IL_48076.6  4WF9 C 2077 G 2645'

 scores better against   6 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.62, deficit  0.35, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.03, deficit  0.29, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.39, deficit -0.04, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.48, deficit  0.26, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.55, deficit  0.00, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CGC*GG (   1) MLPS  -4.75 deficit   1.43 prct   0.00 CutScore  84.93;  Ed  0, 0
ans =

    ' IL_48076.6  5T5A C   50 G   11'

 scores better against   2 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.22, deficit  0.05, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.33, deficit  0.20, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CGC*GG (   1) MLPS  -4.75 deficit   1.43 prct   0.00 CutScore  84.93;  Ed  0, 0
ans =

    ' IL_48076.6  5Y85 C   40 G   10'

 scores better against   2 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.22, deficit  0.05, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.33, deficit  0.20, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               UGG*CG (   1) MLPS  -4.95 deficit   1.62 prct   0.00 CutScore  82.91;  Ed  0, 0
ans =

    ' IL_48076.6  5VOE U   24 G   13'

 scores better against   2 groups: IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.16, deficit  0.00, prct   0.00; IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.68, deficit  0.51, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               GGC*GC (   1) MLPS  -5.16 deficit   1.84 prct   0.00 CutScore  80.68;  Ed  0, 0
ans =

    ' IL_48076.6  4LFB G  594 C  645'

 scores better against   4 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.39, deficit  0.22, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.53, deficit  0.40, prct   0.00; IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.54, deficit  0.37, prct   0.00; IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.72, deficit  0.00, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               UGC*GA (   1) MLPS  -5.28 deficit   1.96 prct   0.00 CutScore  79.35;  Ed  0, 0
ans =

    ' IL_48076.6  8TSV U    6 A   20'

 scores better against   4 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.26, deficit  0.09, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -3.54, deficit  0.41, prct   0.00; IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -5.25, deficit  2.09, prct   0.00; IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -5.26, deficit  0.54, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               UGA*UG (   1) MLPS  -5.32 deficit   2.00 prct   0.00 CutScore  78.93;  Ed  0, 0
ans =

    ' IL_48076.6  9DFE U 2457 G 2494'

 scores better against   2 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.39, deficit  0.22, prct   0.00; IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.41, deficit  0.25, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               UGA*UG (   1) MLPS  -5.32 deficit   2.00 prct   0.00 CutScore  78.93;  Ed  0, 0
ans =

    ' IL_48076.6  7A0S U 2436 G 2473'

 scores better against   2 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.39, deficit  0.22, prct   0.00; IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.41, deficit  0.25, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               UGU*GA (   1) MLPS  -6.91 deficit   3.58 prct   0.00 CutScore  62.27;  Ed  0, 0
ans =

    ' IL_48076.6  3SUX U   47 A   38'

 scores better against   2 groups: IL_00225.13,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -5.14, deficit  1.97, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  4, 0, MLPS -5.70, deficit  2.57, prct   0.00; 
Better:  21 Equal:   0 Score 0.00              GAAA*UC (   1) MLPS  -7.52 deficit   4.20 prct   0.00 CutScore  55.78;  Ed  0, 0
ans =

    ' IL_48076.6  5J7L G 1087 C 1102'

 scores better against  21 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.64, deficit  0.38, prct   0.00; IL_02555.1,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -3.70, deficit  1.40, prct   0.00; IL_14368.1,  6 NTs, cWW-L-cWW-cSH                           , Ed  3, 1, MLPS -3.98, deficit  1.56, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -4.19, deficit  0.26, prct   0.00; IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  1, 1, MLPS -4.23, deficit  0.73, prct   0.00; 
Better:  23 Equal:   0 Score 0.00              AAAA*UU (   1) MLPS  -7.85 deficit   4.52 prct   0.00 CutScore  52.38;  Ed  0, 0
ans =

    ' IL_48076.6  4V9F A 1191 U 1206'

 scores better against  23 groups: IL_02555.1,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -3.71, deficit  1.41, prct   0.00; IL_14368.1,  6 NTs, cWW-L-cWW-cSH                           , Ed  3, 1, MLPS -3.96, deficit  1.54, prct   0.00; IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -4.09, deficit  0.82, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -4.21, deficit  0.28, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.33, deficit  0.25, prct   0.00; 
Better:  12 Equal:   0 Score 0.00              UUUC*GG (   1) MLPS  -8.51 deficit   5.19 prct   0.00 CutScore  45.39;  Ed  0, 0
ans =

    ' IL_48076.6  8P9A U 1819 G 1624'

 scores better against  12 groups: IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -5.78, deficit  1.05, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -6.38, deficit  2.22, prct   0.00; IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  3, 2, MLPS -6.47, deficit  3.10, prct   0.00; IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  0, 0, MLPS -6.57, deficit  2.08, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  4, 0, MLPS -6.92, deficit  2.64, prct   0.00; 
Group 209 is from IL_51454.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_51454.3
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00               CAC*GG (   1) MLPS  -2.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51454.3  4LFB C 1226 G  954'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               CAC*GG (   1) MLPS  -2.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51454.3  5J7L C 1226 G  954'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               CAC*GG (   1) MLPS  -2.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51454.3  8CRE C 1445 G 1164'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               CAC*GG (   1) MLPS  -2.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51454.3  4UYK C  122 G   78'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               CAC*GG (   1) MLPS  -2.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51454.3  4LFB C 1260 G 1274'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               CAC*GG (   1) MLPS  -2.74 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51454.3  8P9A C 1459 G 1179'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.75 deficit   0.01 prct   0.00 CutScore  99.87;  Ed  0, 0
ans =

    ' IL_51454.3  4V9F U 1009 A  957'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.75 deficit   0.01 prct   0.00 CutScore  99.87;  Ed  0, 0
ans =

    ' IL_51454.3  7A0S U  925 A  876'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.75 deficit   0.01 prct   0.00 CutScore  99.87;  Ed  0, 0
ans =

    ' IL_51454.3  5J7L U  434 A   44'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.75 deficit   0.01 prct   0.00 CutScore  99.87;  Ed  0, 0
ans =

    ' IL_51454.3  4WF9 U  958 A  908'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.75 deficit   0.01 prct   0.00 CutScore  99.87;  Ed  0, 0
ans =

    ' IL_51454.3  9DFE U  913 A  863'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.75 deficit   0.01 prct   0.00 CutScore  99.87;  Ed  0, 0
ans =

    ' IL_51454.3  7A0S U  447 A   43'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               UCC*GA (   1) MLPS  -2.75 deficit   0.01 prct   0.00 CutScore  99.87;  Ed  0, 0
ans =

    ' IL_51454.3  9DFE U  434 A   43'

 matches the original group, cWW-cSH-cWW
Better:   1 Equal:   0 Score 0.00               CAG*CG (   1) MLPS  -3.03 deficit   0.29 prct   0.00 CutScore  96.97;  Ed  0, 0
ans =

    ' IL_51454.3  5ML7 C 2177 G 2202'

 scores better against   1 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.62, deficit  0.35, prct   0.00; 
Better:   0 Equal:   0 Score 1.00               CAU*AG (   1) MLPS  -3.03 deficit   0.29 prct   0.00 CutScore  96.94;  Ed  0, 0
ans =

    ' IL_51454.3  8CRE C   50 G  427'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               CAU*AG (   1) MLPS  -3.03 deficit   0.29 prct   0.00 CutScore  96.94;  Ed  0, 0
ans =

    ' IL_51454.3  8P9A C   50 G  429'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               CAU*AG (   1) MLPS  -3.03 deficit   0.29 prct   0.00 CutScore  96.94;  Ed  0, 0
ans =

    ' IL_51454.3  4LFB C   54 G  357'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00               CAU*AG (   1) MLPS  -3.03 deficit   0.29 prct   0.00 CutScore  96.94;  Ed  0, 0
ans =

    ' IL_51454.3  5J7L C   54 G  357'

 matches the original group, cWW-cSH-cWW
Better:   2 Equal:   0 Score 0.00               CUG*CG (   1) MLPS  -3.96 deficit   1.22 prct   0.00 CutScore  87.14;  Ed  0, 0
ans =

    ' IL_51454.3  6DLR C   39 G   22'

 scores better against   2 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.20, deficit  1.05, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.84, deficit  0.62, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CUG*CG (   1) MLPS  -3.96 deficit   1.22 prct   0.00 CutScore  87.14;  Ed  0, 0
ans =

    ' IL_51454.3  7MLW C   45 G   17'

 scores better against   2 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.20, deficit  1.05, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.84, deficit  0.62, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CUG*CG (   1) MLPS  -3.96 deficit   1.22 prct   0.00 CutScore  87.14;  Ed  0, 0
ans =

    ' IL_51454.3  5T83 C   36 G   22'

 scores better against   2 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.20, deficit  1.05, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.84, deficit  0.62, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CUG*CG (   1) MLPS  -3.96 deficit   1.22 prct   0.00 CutScore  87.14;  Ed  0, 0
ans =

    ' IL_51454.3  8CRE C 1291 G 1303'

 scores better against   2 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.20, deficit  1.05, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.84, deficit  0.62, prct   0.00; 
Better:   2 Equal:   0 Score 0.00               CUG*CG (   1) MLPS  -3.96 deficit   1.22 prct   0.00 CutScore  87.14;  Ed  0, 0
ans =

    ' IL_51454.3  8P9A C 1306 G 1318'

 scores better against   2 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.20, deficit  1.05, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.84, deficit  0.62, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               UAG*CA (   1) MLPS  -4.48 deficit   1.74 prct   0.00 CutScore  81.64;  Ed  0, 0
ans =

    ' IL_51454.3  2QWY U   40 A   24'

 scores better against   4 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.95, deficit  0.69, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.48, deficit  0.05, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.62, deficit  0.06, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.83, deficit  0.60, prct   0.00; 
Better:   4 Equal:   0 Score 0.00               UAG*CA (   1) MLPS  -4.48 deficit   1.74 prct   0.00 CutScore  81.64;  Ed  0, 0
ans =

    ' IL_51454.3  9DFE U  877 A  899'

 scores better against   4 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.95, deficit  0.69, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.48, deficit  0.05, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.62, deficit  0.06, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.83, deficit  0.60, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.62 deficit   1.88 prct   0.00 CutScore  80.21;  Ed  0, 0
ans =

    ' IL_51454.3  8CRE U 2779 A 2391'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.62 deficit   1.88 prct   0.00 CutScore  80.21;  Ed  0, 0
ans =

    ' IL_51454.3  7A0S U 2417 A 2054'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.62 deficit   1.88 prct   0.00 CutScore  80.21;  Ed  0, 0
ans =

    ' IL_51454.3  4V9F U 2473 A 2112'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.62 deficit   1.88 prct   0.00 CutScore  80.21;  Ed  0, 0
ans =

    ' IL_51454.3  9DFE U 2438 A 2071'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.62 deficit   1.88 prct   0.00 CutScore  80.21;  Ed  0, 0
ans =

    ' IL_51454.3  4WF9 U 2465 A 2098'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              UACC*GA (   1) MLPS  -4.62 deficit   1.88 prct   0.00 CutScore  80.21;  Ed  0, 0
ans =

    ' IL_51454.3  8P9A U 2807 A 2413'

 matches the original group, cWW-cSH-cWW
Better:   6 Equal:   0 Score 0.00               UAA*UA (   1) MLPS  -4.66 deficit   1.92 prct   0.00 CutScore  79.74;  Ed  0, 0
ans =

    ' IL_51454.3  8CRE U  531 A  516'

 scores better against   6 groups: IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.84, deficit  0.41, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.90, deficit  0.34, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.96, deficit  1.70, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.17, deficit  0.95, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.23, deficit  0.91, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              UACU*AA (   1) MLPS  -4.91 deficit   2.17 prct   0.00 CutScore  77.15;  Ed  0, 0
ans =

    ' IL_51454.3  5J7L U 2438 A 2071'

 matches the original group, cWW-cSH-cWW
Better:   4 Equal:   0 Score 0.00               UAC*GG (   1) MLPS  -5.02 deficit   2.28 prct   0.00 CutScore  76.02;  Ed  0, 0
ans =

    ' IL_51454.3  9C75 U   35 G   10'

 scores better against   4 groups: IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.68, deficit  0.35, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.77, deficit  1.50, prct   0.00; IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.95, deficit  0.79, prct   0.00; IL_33761.2,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.96, deficit  0.16, prct   0.00; 
Better:   6 Equal:   0 Score 0.00               UUU*AA (   1) MLPS  -5.08 deficit   2.34 prct   0.00 CutScore  75.36;  Ed  0, 0
ans =

    ' IL_51454.3  8CRE U 1046 A  994'

 scores better against   6 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.43, deficit  0.26, prct   0.00; IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.00, deficit  1.85, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -4.11, deficit  0.56, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -4.70, deficit  1.47, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  3, 1, MLPS -4.71, deficit  0.20, prct   0.00; 
Better:   6 Equal:   0 Score 0.00               UUU*AA (   1) MLPS  -5.08 deficit   2.34 prct   0.00 CutScore  75.36;  Ed  0, 0
ans =

    ' IL_51454.3  8P9A U 1050 A  998'

 scores better against   6 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.43, deficit  0.26, prct   0.00; IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.00, deficit  1.85, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -4.11, deficit  0.56, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -4.70, deficit  1.47, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  3, 1, MLPS -4.71, deficit  0.20, prct   0.00; 
Better:   9 Equal:   0 Score 0.00               GAG*CC (   1) MLPS  -5.26 deficit   2.53 prct   0.00 CutScore  73.40;  Ed  0, 0
ans =

    ' IL_51454.3  1U6B G  128 C  178'

 scores better against   9 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.27, deficit  0.00, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.22, deficit  0.00, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.61, deficit  0.06, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -4.81, deficit  0.30, prct   0.00; 
Better:   6 Equal:   0 Score 0.00               GAU*AC (   1) MLPS  -5.27 deficit   2.53 prct   0.00 CutScore  73.37;  Ed  0, 0
ans =

    ' IL_51454.3  3IWN G   89 C    3'

 scores better against   6 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.10, deficit  0.83, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.62, deficit  0.19, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.74, deficit  0.51, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  4, 0, MLPS -4.87, deficit  0.36, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -4.89, deficit  0.07, prct   0.00; 
Better:   3 Equal:   0 Score 0.00               ACA*UU (   1) MLPS  -5.32 deficit   2.59 prct   0.00 CutScore  72.79;  Ed  0, 0
ans =

    ' IL_51454.3  8P9A A  518 U  533'

 scores better against   3 groups: IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.50, deficit  0.96, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.45, deficit  1.01, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -4.88, deficit  1.56, prct   0.00; 
Better:   3 Equal:   0 Score 0.00               ACA*UU (   1) MLPS  -5.32 deficit   2.59 prct   0.00 CutScore  72.79;  Ed  0, 0
ans =

    ' IL_51454.3  8CRE A  516 U  531'

 scores better against   3 groups: IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.50, deficit  0.96, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.45, deficit  1.01, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -4.88, deficit  1.56, prct   0.00; 
Better:   9 Equal:   0 Score 0.00               GAA*UC (   1) MLPS  -5.45 deficit   2.71 prct   0.00 CutScore  71.51;  Ed  0, 0
ans =

    ' IL_51454.3  6DTD G   22 C   16'

 scores better against   9 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.28, deficit  1.01, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.57, deficit  0.34, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.79, deficit  0.36, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.89, deficit  0.34, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.11, deficit  0.78, prct   0.00; 
Better:   5 Equal:   0 Score 0.00               UUA*UG (   1) MLPS  -5.80 deficit   3.06 prct   0.00 CutScore  67.80;  Ed  0, 0
ans =

    ' IL_51454.3  4R4V U  777 G  608'

 scores better against   5 groups: IL_89505.4,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.35, deficit  2.20, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -4.48, deficit  1.16, prct   0.00; IL_07039.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.63, deficit  1.47, prct   0.00; IL_33761.2,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -5.68, deficit  1.89, prct   0.00; IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  2, 1, MLPS -5.77, deficit  1.04, prct   0.00; 
Better:   5 Equal:   0 Score 0.00               CCU*AG (   1) MLPS  -5.88 deficit   3.14 prct   0.00 CutScore  66.90;  Ed  0, 0
ans =

    ' IL_51454.3  7TZS C   23 G   36'

 scores better against   5 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.26, deficit  0.10, prct   0.00; IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.27, deficit  0.73, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.23, deficit  0.80, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.55, deficit  2.42, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -5.88, deficit  2.65, prct   0.00; 
Better:   5 Equal:   0 Score 0.00               CCU*AG (   1) MLPS  -5.88 deficit   3.14 prct   0.00 CutScore  66.90;  Ed  0, 0
ans =

    ' IL_51454.3  3K0J C   18 G   36'

 scores better against   5 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.26, deficit  0.10, prct   0.00; IL_61258.15,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.27, deficit  0.73, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.23, deficit  0.80, prct   0.00; IL_16386.4,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.55, deficit  2.42, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -5.88, deficit  2.65, prct   0.00; 
Better:  16 Equal:   0 Score 0.00              CUUG*CG (   1) MLPS  -8.39 deficit   5.65 prct   0.00 CutScore  40.52;  Ed  0, 0
ans =

    ' IL_51454.3  8CRE C  439 G  488'

 scores better against  16 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.21, deficit  0.05, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  1, 0, MLPS -4.36, deficit  0.08, prct   0.00; IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  4, 1, MLPS -4.70, deficit  1.84, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -5.21, deficit  0.19, prct   0.00; IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -5.76, deficit  1.03, prct   0.00; 
Group 276 is from IL_68140.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_68140.4
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GAAG*CC (   1) MLPS  -3.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68140.4  9DFE G   51 C   31'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GAAG*CC (   1) MLPS  -3.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68140.4  4V9F G   50 C   30'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GAAG*CC (   1) MLPS  -3.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68140.4  4WF9 G   49 C   29'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GAAG*CC (   1) MLPS  -3.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68140.4  5J7L G 1846 C 1894'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GAAG*CC (   1) MLPS  -3.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68140.4  5J7L G   51 C   31'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GAAG*CC (   1) MLPS  -3.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68140.4  7A0S G 1838 C 1877'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GAAG*CC (   1) MLPS  -3.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68140.4  4WF9 G 1873 C 1921'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GAAU*AC (   1) MLPS  -3.46 deficit   0.20 prct   0.00 CutScore  97.92;  Ed  0, 0
ans =

    ' IL_68140.4  8P9A G  802 C  747'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GAAU*AC (   1) MLPS  -3.46 deficit   0.20 prct   0.00 CutScore  97.92;  Ed  0, 0
ans =

    ' IL_68140.4  8CRE G  786 C  732'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              AAAC*GU (   1) MLPS  -3.85 deficit   0.59 prct   0.00 CutScore  93.81;  Ed  0, 0
ans =

    ' IL_68140.4  1S03 A   12 U   38'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              AAAC*GU (   1) MLPS  -3.85 deficit   0.59 prct   0.00 CutScore  93.81;  Ed  0, 0
ans =

    ' IL_68140.4  1S03 A   12 U   38'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              GUAU*AC (   1) MLPS  -3.94 deficit   0.67 prct   0.00 CutScore  92.91;  Ed  0, 0
ans =

    ' IL_68140.4  4V9F G 1902 C 1935'

 matches the original group, cWW-cSH-cWW
Better:   1 Equal:   0 Score 0.00              CAAG*CG (   1) MLPS  -4.13 deficit   0.86 prct   0.00 CutScore  90.92;  Ed  0, 0
ans =

    ' IL_68140.4  1U9S C  164 G  134'

 scores better against   1 groups: IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.05, deficit  0.12, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              AUAC*GU (   1) MLPS  -4.33 deficit   1.06 prct   0.00 CutScore  88.80;  Ed  0, 0
ans =

    ' IL_68140.4  5J7L A  640 U  598'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              AUAC*GU (   1) MLPS  -4.33 deficit   1.06 prct   0.00 CutScore  88.80;  Ed  0, 0
ans =

    ' IL_68140.4  4LFB A  640 U  598'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              AUAC*GU (   1) MLPS  -4.33 deficit   1.06 prct   0.00 CutScore  88.80;  Ed  0, 0
ans =

    ' IL_68140.4  1I6U A   24 U   13'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00              AUAU*AU (   1) MLPS  -4.38 deficit   1.11 prct   0.00 CutScore  88.27;  Ed  0, 0
ans =

    ' IL_68140.4  4PDB A   24 U   15'

 matches the original group, cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00             GAAAG*CC (   1) MLPS  -6.74 deficit   3.48 prct   0.00 CutScore  63.36;  Ed  0, 0
ans =

    ' IL_68140.4  1U9S G  111 C  229'

 matches the original group, cWW-cSH-cWW
Group 141 is from IL_33711.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_33711.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cSH-cWW-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         AACAUACUC*GU (   1) MLPS  -8.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_33711.1  6N2V A   45 U   65'

 matches the original group, cWW-cSH-cWW-L-L-R-L
Better:   0 Equal:   0 Score 1.00         GUCAAUUCG*CC (   1) MLPS  -8.02 deficit   0.02 prct   0.00 CutScore  99.90;  Ed  0, 0
ans =

    ' IL_33711.1  6CB3 G   38 C   60'

 matches the original group, cWW-cSH-cWW-L-L-R-L
Group 208 is from IL_51387.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_51387.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cSH-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GGUG*CUC (   1) MLPS  -4.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51387.2  9DFE G  738 C  758'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GGUG*CUC (   1) MLPS  -4.95 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51387.2  7A0S G  751 C  771'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GGUU*AUC (   1) MLPS  -4.96 deficit   0.01 prct   0.00 CutScore  99.86;  Ed  0, 0
ans =

    ' IL_51387.2  8P9A G  869 C  890'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GGUU*AUC (   1) MLPS  -4.96 deficit   0.01 prct   0.00 CutScore  99.86;  Ed  0, 0
ans =

    ' IL_51387.2  8CRE G  865 C  886'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GUUG*CUC (   1) MLPS  -5.33 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_51387.2  4V9F G  830 C  851'

 matches the original group, cWW-cSH-cWW-cWW
Better:   1 Equal:   0 Score 0.00            GGUUU*AUC (   1) MLPS  -5.90 deficit   0.95 prct   0.00 CutScore  89.95;  Ed  0, 0
ans =

    ' IL_51387.2  9DFE G 2489 C 2461'

 scores better against   1 groups: IL_22373.1,  8 NTs, cWW-L-R-cSH-cSH-cWW                     , Ed  2, 0, MLPS -4.30, deficit  0.72, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            GGUUU*AUC (   1) MLPS  -5.90 deficit   0.95 prct   0.00 CutScore  89.95;  Ed  0, 0
ans =

    ' IL_51387.2  4WF9 G 2516 C 2488'

 scores better against   1 groups: IL_22373.1,  8 NTs, cWW-L-R-cSH-cSH-cWW                     , Ed  2, 0, MLPS -4.30, deficit  0.72, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            GGUUU*AUC (   1) MLPS  -5.90 deficit   0.95 prct   0.00 CutScore  89.95;  Ed  0, 0
ans =

    ' IL_51387.2  7A0S G 2468 C 2440'

 scores better against   1 groups: IL_22373.1,  8 NTs, cWW-L-R-cSH-cSH-cWW                     , Ed  2, 0, MLPS -4.30, deficit  0.72, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            UGUUU*AUA (   1) MLPS  -6.28 deficit   1.33 prct   0.00 CutScore  86.03;  Ed  0, 0
ans =

    ' IL_51387.2  5J7L U 2489 A 2461'

 scores better against   1 groups: IL_22373.1,  8 NTs, cWW-L-R-cSH-cSH-cWW                     , Ed  4, 0, MLPS -4.52, deficit  0.95, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            GAGUG*CUC (   1) MLPS  -6.37 deficit   1.42 prct   0.00 CutScore  85.07;  Ed  0, 0
ans =

    ' IL_51387.2  5D8H G 1197 C 1212'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GAGUG*CUC (   1) MLPS  -6.37 deficit   1.42 prct   0.00 CutScore  85.07;  Ed  0, 0
ans =

    ' IL_51387.2  1MMS G 1087 C 1102'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GAGUG*CUC (   1) MLPS  -6.37 deficit   1.42 prct   0.00 CutScore  85.07;  Ed  0, 0
ans =

    ' IL_51387.2  8CRE G 1258 C 1273'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GAGUG*CUC (   1) MLPS  -6.37 deficit   1.42 prct   0.00 CutScore  85.07;  Ed  0, 0
ans =

    ' IL_51387.2  8P9A G 1262 C 1277'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUUC*GUA (   1) MLPS  -6.77 deficit   1.82 prct   0.00 CutScore  80.87;  Ed  0, 0
ans =

    ' IL_51387.2  8CRE U  257 A  204'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUUC*GUA (   1) MLPS  -6.77 deficit   1.82 prct   0.00 CutScore  80.87;  Ed  0, 0
ans =

    ' IL_51387.2  8P9A U  259 A  206'

 matches the original group, cWW-cSH-cWW-cWW
Better:   4 Equal:   0 Score 0.00             CAAC*GCG (   1) MLPS  -7.11 deficit   2.16 prct   0.00 CutScore  77.30;  Ed  0, 0
ans =

    ' IL_51387.2  4V9F C  440 G   41'

 scores better against   4 groups: IL_61438.4,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -2.93, deficit  0.20, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  3, 1, MLPS -5.65, deficit -0.07, prct   0.00; IL_09990.4,  7 NTs, cWW-L-R-L-cWW                           , Ed  5, 1, MLPS -6.73, deficit  2.28, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 0, MLPS -6.91, deficit  1.33, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            GGCUU*GUC (   1) MLPS  -8.18 deficit   3.23 prct   0.00 CutScore  66.04;  Ed  0, 0
ans =

    ' IL_51387.2  4V9F G 2524 C 2496'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUUU*GUG (   1) MLPS  -8.48 deficit   3.53 prct   0.00 CutScore  62.82;  Ed  0, 0
ans =

    ' IL_51387.2  8P9A U 2858 G 2830'

 matches the original group, cWW-cSH-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUUU*GUG (   1) MLPS  -8.48 deficit   3.53 prct   0.00 CutScore  62.82;  Ed  0, 0
ans =

    ' IL_51387.2  8CRE U 2830 G 2802'

 matches the original group, cWW-cSH-cWW-cWW
Better:   7 Equal:   0 Score 0.00             CUCC*GUG (   1) MLPS  -9.38 deficit   4.43 prct   0.00 CutScore  53.35;  Ed  0, 0
ans =

    ' IL_51387.2  3PDR C   33 G  151'

 scores better against   7 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  4, 1, MLPS -7.00, deficit  1.03, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -8.38, deficit  3.24, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  4, 2, MLPS -8.50, deficit  2.78, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 1, MLPS -8.53, deficit  1.49, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -8.68, deficit  3.11, prct   0.00; 
Group 144 is from IL_34470.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_34470.3
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-cSH-cWW-tHH-tWH-tHS-cWW-tSH-R-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   GAUGAGUAG*UGAAAGGC (   1) MLPS  -8.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_34470.3  3DIL G   22 C   70'

 matches the original group, cWW-cSH-cWW-tHH-tWH-tHS-cWW-tSH-R-cWW-L
Better:   0 Equal:   0 Score 1.00   GAUGAGUAG*UGAAAGGC (   1) MLPS  -8.96 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_34470.3  3D0U G   19 C   67'

 matches the original group, cWW-cSH-cWW-tHH-tWH-tHS-cWW-tSH-R-cWW-L
Group 163 is from IL_42032.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_42032.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cSH-cWW-tWH-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GAGGAAG*CUGC (   1) MLPS  -4.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42032.1  4LFB G 1175 C 1161'

 matches the original group, cWW-cSH-cWW-tWH-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00         GAGGAAG*CUGC (   1) MLPS  -4.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42032.1  5J7L G 1175 C 1161'

 matches the original group, cWW-cSH-cWW-tWH-L-cWW-L-L
Group 302 is from IL_73759.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_73759.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cSH-tHS-cWH-cHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GAGGGG*CGGUC (   1) MLPS  -4.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_73759.1  7OAX G   10 C   44'

 matches the original group, cWW-cSH-tHS-cWH-cHW-cWW
Group 126 is from IL_30441.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_30441.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cSH-tSW-tHW-cWW-L-L-R-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00   GUUACGUCCGAAAG*CAC (   1) MLPS -10.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_30441.1  8GXB G    6 C   40'

 scores better against   1 groups: IL_96303.1, 13 NTs, cWW-cSH-tSW-tHW-cWW-L-L-R-L-R           , Ed  0, 0, MLPS -10.65, deficit  1.30, prct   0.00; 
Group 398 is from IL_96303.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_96303.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cSH-tSW-tHW-cWW-L-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   GUUGCGUCCGAAAG*CAC (   1) MLPS  -9.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_96303.1  8HBA G    6 C   32'

 matches the original group, cWW-cSH-tSW-tHW-cWW-L-L-R-L-R
Better:   0 Equal:   0 Score 1.00   GUUGCGUCCGAAAG*CAC (   1) MLPS  -9.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_96303.1  8I3Z G    6 C   32'

 matches the original group, cWW-cSH-tSW-tHW-cWW-L-L-R-L-R
Better:   0 Equal:   0 Score 1.00   GUUACGUCCGAAAG*CAC (   1) MLPS -10.65 deficit   1.30 prct   0.00 CutScore  93.66;  Ed  0, 0
ans =

    ' IL_96303.1  8GXB G    6 C   40'

 matches the original group, cWW-cSH-tSW-tHW-cWW-L-L-R-L-R
Group  48 is from IL_11344.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_11344.2
This group is considered to be structured ***************************
Number of NTs:  5  Signature: cWW-cSS-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CGGACC*GAAG (   1) MLPS  -8.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_11344.2  5J7L C 1277 G 1258'

 matches the original group, cWW-cSS-L-cWW
Better:   1 Equal:   0 Score 0.00          CUAAUC*GAUG (   1) MLPS  -9.26 deficit   0.85 prct   0.00 CutScore  93.44;  Ed  0, 0
ans =

    ' IL_11344.2  4LFB C 1277 G 1258'

 scores better against   1 groups: IL_90346.1,  9 NTs, cWW-L-R-L-cWW-L-L                       , Ed  2, 2, MLPS -9.11, deficit  2.20, prct   0.00; 
Group 278 is from IL_68405.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_68405.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cSS-L-tWH-tHW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CAACAGC*GACAUG (   1) MLPS  -7.70 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68405.1  2R8S C  121 G  200'

 matches the original group, cWW-cSS-L-tWH-tHW-cWW-cWW
Group 186 is from IL_46174.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46174.3
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-cSS-tSS-tSH-L-cWW-tHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CGACGACG*CAUCAG (   1) MLPS  -8.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_46174.3  4LFB C  277 G  247'

 matches the original group, cWW-cSS-tSS-tSH-L-cWW-tHW-cWW
Better:   0 Equal:   0 Score 1.00      UUUCAACG*UAUCAA (   1) MLPS  -8.87 deficit   0.08 prct   0.00 CutScore  99.59;  Ed  0, 0
ans =

    ' IL_46174.3  8CRE U  346 A  314'

 matches the original group, cWW-cSS-tSS-tSH-L-cWW-tHW-cWW
Better:   0 Equal:   0 Score 1.00      UUUCAACG*UAUCAA (   1) MLPS  -8.87 deficit   0.08 prct   0.00 CutScore  99.59;  Ed  0, 0
ans =

    ' IL_46174.3  8P9A U  348 A  316'

 matches the original group, cWW-cSS-tSS-tSH-L-cWW-tHW-cWW
Better:   0 Equal:   0 Score 1.00      CGACGAUC*GAUUAG (   1) MLPS -10.21 deficit   1.42 prct   0.00 CutScore  92.91;  Ed  0, 0
ans =

    ' IL_46174.3  5J7L C  277 G  247'

 matches the original group, cWW-cSS-tSS-tSH-L-cWW-tHW-cWW
Better:   0 Equal:   0 Score 1.00    CAAUGACG*UAAGACAG (   1) MLPS -13.90 deficit   5.11 prct   0.00 CutScore  74.47;  Ed  0, 0
ans =

    ' IL_46174.3  3RW6 C   43 G   18'

 matches the original group, cWW-cSS-tSS-tSH-L-cWW-tHW-cWW
Group 363 is from IL_87211.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_87211.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cSW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CAUCAG*UG (   1) MLPS  -4.71 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87211.1  5J7L C 1582 G 1416'

 matches the original group, cWW-cSW-L-cWW-L
Group   9 is from IL_02203.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_02203.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cSW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AUUG*CUGU (   1) MLPS  -4.42 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_02203.1  4V9F A  965 U 1003'

 matches the original group, cWW-cSW-cWW-cWW
Group 218 is from IL_54177.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_54177.4
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cSW-tWH-L-R-L-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    GUGCCAG*CGGUAAUUC (   1) MLPS  -5.31 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_54177.4  8P9A G  562 C  583'

 matches the original group, cWW-cSW-tWH-L-R-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00    GUGCCAG*CGGUAAUUC (   1) MLPS  -5.31 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_54177.4  8CRE G  560 C  581'

 matches the original group, cWW-cSW-tWH-L-R-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00    GUGCCAG*CGGUAAUAC (   1) MLPS  -6.27 deficit   0.96 prct   0.00 CutScore  95.95;  Ed  0, 0
ans =

    ' IL_54177.4  5J7L G  515 C  536'

 matches the original group, cWW-cSW-tWH-L-R-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00    GUGCCAG*CGGUAAUAC (   1) MLPS  -6.27 deficit   0.96 prct   0.00 CutScore  95.95;  Ed  0, 0
ans =

    ' IL_54177.4  4LFB G  515 C  536'

 matches the original group, cWW-cSW-tWH-L-R-L-R-tHS-cWW
Group 156 is from IL_38634.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_38634.5
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWH-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGAUC*GCGUA (   1) MLPS  -7.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38634.5  3K0J U   59 A   80'

 matches the original group, cWW-cWH-L-R-cWW
Better:   0 Equal:   0 Score 1.00          UGAAC*GCGCA (   1) MLPS  -7.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38634.5  3D2V U   47 A   68'

 matches the original group, cWW-cWH-L-R-cWW
Group 393 is from IL_95570.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_95570.1
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cWH-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UGUUCG*CAG (   1) MLPS  -6.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_95570.1  6CK5 U   36 G   23'

 matches the original group, cWW-cWH-R-L-cWW
Better:   0 Equal:   0 Score 1.00            UGCAG*CAA (   1) MLPS  -6.50 deficit   0.17 prct   0.00 CutScore  98.66;  Ed  0, 0
ans =

    ' IL_95570.1  4RUM U   38 A   22'

 matches the original group, cWW-cWH-R-L-cWW
Group 177 is from IL_44325.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_44325.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWH-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GCUAG*CAC (   1) MLPS  -5.82 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_44325.1  5LYS G   74 C   35'

 matches the original group, cWW-cWH-cWW-L
Group 202 is from IL_49971.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_49971.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cWH-cWW-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CGCAUUUGG*CGG (   1) MLPS  -5.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_49971.1  1NTA C    5 G  115'

 matches the original group, cWW-cWH-cWW-cWW-L-L-R
Group  57 is from IL_13874.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_13874.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-cWH-tHS-cWW-cSH-cWH-cHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UGGAGGGG*CGGUCG (   1) MLPS  -5.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13874.1  7OAX U    8 G   45'

 matches the original group, cWW-cWH-tHS-cWW-cSH-cWH-cHW-cWW
Group   8 is from IL_01994.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_01994.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWH-tHS-cWW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UGCUG*CGG (   1) MLPS  -4.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_01994.1  7MLW U   43 G   18'

 matches the original group, cWW-cWH-tHS-cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00           GGACUG*CGC (   1) MLPS  -4.22 deficit   0.08 prct   0.00 CutScore  99.47;  Ed  0, 0
ans =

    ' IL_01994.1  6DLR G   36 C   23'

 matches the original group, cWW-cWH-tHS-cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00           GGUCUG*CGC (   1) MLPS  -4.22 deficit   0.08 prct   0.00 CutScore  99.47;  Ed  0, 0
ans =

    ' IL_01994.1  5T83 G   33 C   23'

 matches the original group, cWW-cWH-tHS-cWW-cSH-cWW
Group  30 is from IL_06691.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06691.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cWS-L-R-L-R-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GCGACCG*CAAAC (   1) MLPS  -6.01 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_06691.1  4V9F G  958 C 1008'

 matches the original group, cWW-cWS-L-R-L-R-cWW-L
Better:   0 Equal:   0 Score 1.00         GAACUC*GUUGC (   1) MLPS  -7.08 deficit   1.07 prct   0.00 CutScore  94.66;  Ed  0, 0
ans =

    ' IL_06691.1  5J7L G 1144 C 1128'

 matches the original group, cWW-cWS-L-R-L-R-cWW-L
Group 102 is from IL_24499.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_24499.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-cWS-L-R-L-R-cWW-L-cSH-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        AGAAGCGU*AAUU (   1) MLPS  -7.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_24499.1  7ELQ A    6 U   41'

 matches the original group, cWW-cWS-L-R-L-R-cWW-L-cSH-L
Group 189 is from IL_47078.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47078.3
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cWS-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GACAU*AC (   1) MLPS  -5.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_47078.3  5J7L G  993 C 1045'

 matches the original group, cWW-cWS-L-cWW-L
Better:   0 Equal:   0 Score 1.00             GACAU*AC (   1) MLPS  -5.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_47078.3  4LFB G  993 C 1045'

 matches the original group, cWW-cWS-L-cWW-L
Better:   0 Equal:   0 Score 1.00            UUCCC*GCA (   1) MLPS  -5.72 deficit   0.34 prct   0.00 CutScore  96.45;  Ed  0, 0
ans =

    ' IL_47078.3  5J7L U 1380 A  935'

 matches the original group, cWW-cWS-L-cWW-L
Better:   0 Equal:   0 Score 1.00            UUCCC*GCA (   1) MLPS  -5.72 deficit   0.34 prct   0.00 CutScore  96.45;  Ed  0, 0
ans =

    ' IL_47078.3  4LFB U 1380 A  935'

 matches the original group, cWW-cWS-L-cWW-L
Group 108 is from IL_26222.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_26222.2
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cWS-cSH-tWH-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GCACU*AAAC (   1) MLPS  -2.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26222.2  4WF9 G  909 C  957'

 matches the original group, cWW-cWS-cSH-tWH-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00           GCACU*AAAC (   1) MLPS  -2.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26222.2  7A0S G  877 C  924'

 matches the original group, cWW-cWS-cSH-tWH-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00           GCACU*AAAC (   1) MLPS  -2.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26222.2  9DFE G  864 C  912'

 matches the original group, cWW-cWS-cSH-tWH-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00           GCACU*AAAC (   1) MLPS  -2.20 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26222.2  5J7L G  864 C  912'

 matches the original group, cWW-cWS-cSH-tWH-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00          GCGAAU*AAAC (   1) MLPS  -3.86 deficit   1.67 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_26222.2  8P9A G  999 C 1049'

 matches the original group, cWW-cWS-cSH-tWH-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00          GCGAAU*AAAC (   1) MLPS  -3.86 deficit   1.67 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_26222.2  8CRE G  995 C 1045'

 matches the original group, cWW-cWS-cSH-tWH-R-L-R-cWW
Group 256 is from IL_63596.11 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_63596.11
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cWS-cSH-tWH-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CCACU*ACG (   1) MLPS  -3.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_63596.11  4V9F C 2717 G 2763'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            CCUCU*ACG (   1) MLPS  -3.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_63596.11  4MGN C   29 G   75'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            CCUCU*ACG (   1) MLPS  -3.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_63596.11  5B2P C   76 G   90'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            CCUCU*ACG (   1) MLPS  -3.36 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_63596.11  4JRC C   29 G   75'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            CCUCU*AUG (   1) MLPS  -3.48 deficit   0.13 prct   0.00 CutScore  98.98;  Ed  0, 0
ans =

    ' IL_63596.11  4WF9 C 2707 G 2754'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            CCUCU*AUG (   1) MLPS  -3.48 deficit   0.13 prct   0.00 CutScore  98.98;  Ed  0, 0
ans =

    ' IL_63596.11  9DFE C 2680 G 2727'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            CCACU*AUG (   1) MLPS  -3.48 deficit   0.13 prct   0.00 CutScore  98.98;  Ed  0, 0
ans =

    ' IL_63596.11  1KOG C   96 G   76'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            GCUCU*AUC (   1) MLPS  -4.73 deficit   1.37 prct   0.00 CutScore  88.81;  Ed  0, 0
ans =

    ' IL_63596.11  8HNT G   87 C  122'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            GCUCU*AUC (   1) MLPS  -4.73 deficit   1.37 prct   0.00 CutScore  88.81;  Ed  0, 0
ans =

    ' IL_63596.11  6JDV G  105 C  140'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            GCACU*AGC (   1) MLPS  -5.04 deficit   1.68 prct   0.00 CutScore  86.28;  Ed  0, 0
ans =

    ' IL_63596.11  4V9F G 1425 C 1439'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            CCGCU*AUG (   1) MLPS  -5.48 deficit   2.12 prct   0.00 CutScore  82.68;  Ed  0, 0
ans =

    ' IL_63596.11  7A0S C 2659 G 2707'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00            UCACU*AAA (   1) MLPS  -6.41 deficit   3.06 prct   0.00 CutScore  75.03;  Ed  0, 0
ans =

    ' IL_63596.11  5J7L U 2680 A 2727'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   1 Equal:   0 Score 0.00            GCAAU*AGC (   1) MLPS  -6.49 deficit   3.13 prct   0.00 CutScore  74.43;  Ed  0, 0
ans =

    ' IL_63596.11  9DFE G 1319 C 1333'

 scores better against   1 groups: IL_83150.2,  7 NTs, cWW-tHH-cWW-L-L                         , Ed  3, 1, MLPS -6.16, deficit  0.32, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            GCUCC*GUC (   1) MLPS  -7.20 deficit   3.84 prct   0.00 CutScore  68.62;  Ed  0, 0
ans =

    ' IL_63596.11  6XJQ G    5 C   54'

 scores better against   1 groups: IL_46387.1,  8 NTs, cWW-cWW-L-cWW-L                         , Ed  4, 2, MLPS -6.16, deficit  0.11, prct   0.00; 
Better:   7 Equal:   0 Score 0.00            UCAAC*GGA (   1) MLPS  -8.83 deficit   5.47 prct   0.00 CutScore  55.35;  Ed  0, 0
ans =

    ' IL_63596.11  8P9A U 1501 A 1515'

 scores better against   7 groups: IL_28788.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 1, MLPS -5.65, deficit  0.00, prct   0.00; IL_83150.2,  7 NTs, cWW-tHH-cWW-L-L                         , Ed  5, 1, MLPS -6.44, deficit  0.60, prct   0.00; IL_06549.2,  4 NTs, cWW-cWW                                 , Ed  2, 2, MLPS -6.52, deficit  0.51, prct   0.00; IL_10389.1,  8 NTs, cWW-L-cWW-L-cWW                         , Ed  4, 2, MLPS -7.07, deficit  0.17, prct   0.00; IL_57881.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -7.76, deficit  1.18, prct   0.00; 
Better:   7 Equal:   0 Score 0.00            UCAAC*GGA (   1) MLPS  -8.83 deficit   5.47 prct   0.00 CutScore  55.35;  Ed  0, 0
ans =

    ' IL_63596.11  8CRE U 1497 A 1511'

 scores better against   7 groups: IL_28788.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 1, MLPS -5.65, deficit  0.00, prct   0.00; IL_83150.2,  7 NTs, cWW-tHH-cWW-L-L                         , Ed  5, 1, MLPS -6.44, deficit  0.60, prct   0.00; IL_06549.2,  4 NTs, cWW-cWW                                 , Ed  2, 2, MLPS -6.52, deficit  0.51, prct   0.00; IL_10389.1,  8 NTs, cWW-L-cWW-L-cWW                         , Ed  4, 2, MLPS -7.07, deficit  0.17, prct   0.00; IL_57881.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -7.76, deficit  1.18, prct   0.00; 
Better:   7 Equal:   0 Score 0.00            CCAAC*GGG (   1) MLPS  -8.83 deficit   5.47 prct   0.00 CutScore  55.32;  Ed  0, 0
ans =

    ' IL_63596.11  5J7L C 1319 G 1333'

 scores better against   7 groups: IL_28788.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 1, MLPS -5.73, deficit  0.08, prct   0.00; IL_83150.2,  7 NTs, cWW-tHH-cWW-L-L                         , Ed  5, 1, MLPS -6.54, deficit  0.70, prct   0.00; IL_06549.2,  4 NTs, cWW-cWW                                 , Ed  2, 2, MLPS -6.60, deficit  0.59, prct   0.00; IL_10389.1,  8 NTs, cWW-L-cWW-L-cWW                         , Ed  4, 2, MLPS -7.00, deficit  0.09, prct   0.00; IL_57881.1,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -7.68, deficit  1.10, prct   0.00; 
Better:   0 Equal:   0 Score 1.00           UCCCU*ACCA (   1) MLPS  -9.14 deficit   5.79 prct   0.00 CutScore  52.75;  Ed  0, 0
ans =

    ' IL_63596.11  8P9A U 1617 A 1160'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00           UCCCU*ACCA (   1) MLPS  -9.14 deficit   5.79 prct   0.00 CutScore  52.75;  Ed  0, 0
ans =

    ' IL_63596.11  8CRE U 1604 A 1145'

 matches the original group, cWW-cWS-cSH-tWH-cWW-L
Group   2 is from IL_00555.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_00555.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWS-cWW-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         AUGAAGC*GGGU (   1) MLPS  -7.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00555.1  8P9A A 2520 U 2587'

 matches the original group, cWW-cWS-cWW-L-R
Better:   0 Equal:   0 Score 1.00         AUGAAGC*GGGU (   1) MLPS  -7.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00555.1  8CRE A 2498 U 2559'

 matches the original group, cWW-cWS-cWW-L-R
Group 334 is from IL_81516.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_81516.2
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-cWS-tSH-L-tWH-cWW-tSS-tSH-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  GAGUGAAAAAGAAC*GAAC (   1) MLPS  -6.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_81516.2  5J7L G  496 C  484'

 matches the original group, cWW-cWS-tSH-L-tWH-cWW-tSS-tSH-L-R-L
Better:   0 Equal:   0 Score 1.00  GAGUGAAAUAGAAC*GCAC (   1) MLPS  -6.75 deficit   0.71 prct   0.00 CutScore  96.91;  Ed  0, 0
ans =

    ' IL_81516.2  4WF9 G  541 C  530'

 matches the original group, cWW-cWS-tSH-L-tWH-cWW-tSS-tSH-L-R-L
Better:   0 Equal:   0 Score 1.00  GAGUGAAAGAGAAC*GAAC (   1) MLPS  -6.89 deficit   0.85 prct   0.00 CutScore  96.28;  Ed  0, 0
ans =

    ' IL_81516.2  7A0S G  506 C  495'

 matches the original group, cWW-cWS-tSH-L-tWH-cWW-tSS-tSH-L-R-L
Better:   0 Equal:   0 Score 1.00  GAGUGAAAUAGAGC*GAAC (   1) MLPS  -7.68 deficit   1.64 prct   0.00 CutScore  92.82;  Ed  0, 0
ans =

    ' IL_81516.2  9DFE G  496 C  484'

 matches the original group, cWW-cWS-tSH-L-tWH-cWW-tSS-tSH-L-R-L
Better:   0 Equal:   0 Score 1.00  GAGUGAAAAAGUAC*GAAC (   1) MLPS  -7.80 deficit   1.75 prct   0.00 CutScore  92.31;  Ed  0, 0
ans =

    ' IL_81516.2  8P9A G  390 C  379'

 matches the original group, cWW-cWS-tSH-L-tWH-cWW-tSS-tSH-L-R-L
Better:   0 Equal:   0 Score 1.00  GAGUGAAAAAGUAC*GAAC (   1) MLPS  -7.80 deficit   1.75 prct   0.00 CutScore  92.31;  Ed  0, 0
ans =

    ' IL_81516.2  8CRE G  390 C  379'

 matches the original group, cWW-cWS-tSH-L-tWH-cWW-tSS-tSH-L-R-L
Group  12 is from IL_03109.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_03109.3
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cWS-tWH-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             CCAAU*AG (   1) MLPS  -3.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_03109.3  8P9A C  443 G  461'

 matches the original group, cWW-cWS-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00             CCAAU*AG (   1) MLPS  -3.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_03109.3  8CRE C  441 G  459'

 matches the original group, cWW-cWS-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00             ACAAU*AU (   1) MLPS  -3.75 deficit   0.26 prct   0.00 CutScore  97.22;  Ed  0, 0
ans =

    ' IL_03109.3  5J7L A  371 U  390'

 matches the original group, cWW-cWS-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00             GCAAU*AC (   1) MLPS  -4.58 deficit   1.09 prct   0.00 CutScore  88.48;  Ed  0, 0
ans =

    ' IL_03109.3  4LFB G  371 C  390'

 matches the original group, cWW-cWS-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00             UGACC*GG (   1) MLPS  -6.93 deficit   3.44 prct   0.00 CutScore  63.75;  Ed  0, 0
ans =

    ' IL_03109.3  5J7L U  304 G  293'

 matches the original group, cWW-cWS-tWH-cWW-L
Better:   0 Equal:   0 Score 1.00             UGGCC*GG (   1) MLPS  -8.18 deficit   4.69 prct   0.00 CutScore  50.58;  Ed  0, 0
ans =

    ' IL_03109.3  4LFB U  304 G  293'

 matches the original group, cWW-cWS-tWH-cWW-L
Group  29 is from IL_06549.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06549.2
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GGG*CAAUC (   1) MLPS  -6.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_06549.2  5J7L G  775 C  791'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGG*UAAUC (   1) MLPS  -6.10 deficit   0.09 prct   0.00 CutScore  99.14;  Ed  0, 0
ans =

    ' IL_06549.2  8P9A G  907 C  923'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGG*UAAUC (   1) MLPS  -6.10 deficit   0.09 prct   0.00 CutScore  99.14;  Ed  0, 0
ans =

    ' IL_06549.2  8CRE G  903 C  919'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGA*UAACC (   1) MLPS  -6.52 deficit   0.51 prct   0.00 CutScore  95.08;  Ed  0, 0
ans =

    ' IL_06549.2  7A0S G  788 C  804'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGA*UAACC (   1) MLPS  -6.52 deficit   0.51 prct   0.00 CutScore  95.08;  Ed  0, 0
ans =

    ' IL_06549.2  9DFE G  775 C  791'

 matches the original group, cWW-cWW
Better:   1 Equal:   0 Score 0.00            GCG*CAAUC (   1) MLPS  -7.31 deficit   1.30 prct   0.00 CutScore  87.38;  Ed  0, 0
ans =

    ' IL_06549.2  4WF9 G  820 C  836'

 scores better against   1 groups: IL_36516.3,  8 NTs, cWW-cWW-cSH-cWW-L                       , Ed  4, 1, MLPS -6.55, deficit  0.29, prct   0.00; 
Group 167 is from IL_42626.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_42626.2
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CU*AACG (   1) MLPS  -4.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42626.2  8P9A C 2881 G 2943'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CU*AACG (   1) MLPS  -4.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42626.2  8CRE C 2853 G 2915'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              CU*AACG (   1) MLPS  -4.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42626.2  8CRE C 3035 G 3052'

 matches the original group, cWW-cWW
Better:   1 Equal:   0 Score 0.00              CA*UACG (   1) MLPS  -5.01 deficit   0.17 prct   0.00 CutScore  98.26;  Ed  0, 0
ans =

    ' IL_42626.2  4WF9 C 2539 G 2601'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.91, deficit  2.17, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CA*UACG (   1) MLPS  -5.01 deficit   0.17 prct   0.00 CutScore  98.26;  Ed  0, 0
ans =

    ' IL_42626.2  5J7L C 2512 G 2574'

 scores better against   1 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.91, deficit  2.17, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CG*CACG (   1) MLPS  -5.02 deficit   0.17 prct   0.00 CutScore  98.23;  Ed  0, 0
ans =

    ' IL_42626.2  9DFE C 2512 G 2574'

 scores better against   1 groups: IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  4, 1, MLPS -4.70, deficit  1.84, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CG*CACG (   1) MLPS  -5.02 deficit   0.17 prct   0.00 CutScore  98.23;  Ed  0, 0
ans =

    ' IL_42626.2  7A0S C 2491 G 2553'

 scores better against   1 groups: IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  4, 1, MLPS -4.70, deficit  1.84, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UA*UACG (   1) MLPS  -5.54 deficit   0.69 prct   0.00 CutScore  92.69;  Ed  0, 0
ans =

    ' IL_42626.2  3IGI U  365 G  378'

 scores better against   1 groups: IL_02555.1,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -5.46, deficit  3.16, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UG*CACG (   1) MLPS  -5.55 deficit   0.70 prct   0.00 CutScore  92.66;  Ed  0, 0
ans =

    ' IL_42626.2  1KXK U   28 G   45'

 scores better against   1 groups: IL_02555.1,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -5.25, deficit  2.94, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              CC*GUCG (   1) MLPS  -6.00 deficit   1.16 prct   0.00 CutScore  87.83;  Ed  0, 0
ans =

    ' IL_42626.2  4V9F C 2547 G 2609'

 scores better against   2 groups: IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -5.10, deficit  0.07, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.76, deficit  1.60, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              UU*AUAG (   1) MLPS  -6.20 deficit   1.35 prct   0.00 CutScore  85.79;  Ed  0, 0
ans =

    ' IL_42626.2  4WF9 U 2722 G 2741'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UU*ACUG (   1) MLPS  -6.28 deficit   1.43 prct   0.00 CutScore  84.98;  Ed  0, 0
ans =

    ' IL_42626.2  5J7L U 2695 G 2714'

 matches the original group, cWW-cWW
Better:   5 Equal:   0 Score 0.00             CU*AUAAG (   1) MLPS  -8.30 deficit   3.46 prct   0.00 CutScore  63.63;  Ed  0, 0
ans =

    ' IL_42626.2  9DFE C 2695 G 2714'

 scores better against   5 groups: IL_94967.1,  6 NTs, cWW-L-cWW-L                             , Ed  6, 2, MLPS -7.59, deficit  2.35, prct   0.00; IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  3, 1, MLPS -7.66, deficit  4.40, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -7.91, deficit  3.83, prct   0.00; IL_47078.3,  7 NTs, cWW-cWS-L-cWW-L                         , Ed  6, 2, MLPS -8.05, deficit  2.66, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -8.10, deficit  2.53, prct   0.00; 
Better:   6 Equal:   0 Score 0.00             CU*ACAUG (   1) MLPS  -8.38 deficit   3.53 prct   0.00 CutScore  62.82;  Ed  0, 0
ans =

    ' IL_42626.2  7A0S C 2674 G 2694'

 scores better against   6 groups: IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  2, 1, MLPS -7.17, deficit  3.22, prct   0.00; IL_94967.1,  6 NTs, cWW-L-cWW-L                             , Ed  6, 2, MLPS -7.59, deficit  2.35, prct   0.00; IL_07171.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 1, MLPS -8.02, deficit  3.18, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -8.10, deficit  2.53, prct   0.00; IL_82741.2,  7 NTs, cWW-L-cWW-L-L                           , Ed  5, 1, MLPS -8.25, deficit  2.37, prct   0.00; 
Group 168 is from IL_42771.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_42771.1
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   6 Equal:   0 Score 0.00               CAA*UG (   1) MLPS  -4.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_42771.1  8T29 C   54 G   66'

 scores better against   6 groups: IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -3.21, deficit  0.47, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.63, deficit  1.36, prct   0.00; IL_48076.6,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.70, deficit  0.38, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.75, deficit  0.32, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.82, deficit  0.60, prct   0.00; 
Better:   6 Equal:   0 Score 0.00               AAA*UU (   1) MLPS  -4.56 deficit   0.06 prct   0.00 CutScore  99.42;  Ed  0, 0
ans =

    ' IL_42771.1  4PWD A  715 U  813'

 scores better against   6 groups: IL_63775.1,  5 NTs, cWW-L-cWW                               , Ed  5, 1, MLPS -3.44, deficit  0.27, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.80, deficit  0.37, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.84, deficit  0.28, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -3.95, deficit  0.72, prct   0.00; IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.07, deficit  1.80, prct   0.00; 
Better:   5 Equal:   0 Score 0.00               CAG*CG (   1) MLPS  -4.70 deficit   0.19 prct   0.00 CutScore  97.98;  Ed  0, 0
ans =

    ' IL_42771.1  4V9F C 2636 G 2627'

 scores better against   5 groups: IL_31462.6,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -2.62, deficit  0.35, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.03, deficit  0.29, prct   0.00; IL_26793.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.39, deficit -0.04, prct   0.00; IL_90729.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.48, deficit  0.26, prct   0.00; IL_10569.1,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -3.55, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UUA*UUA (   1) MLPS  -4.81 deficit   0.31 prct   0.00 CutScore  96.77;  Ed  0, 0
ans =

    ' IL_42771.1  6JQ5 U   34 A   60'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.41, deficit  1.61, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UUA*UUA (   1) MLPS  -4.81 deficit   0.31 prct   0.00 CutScore  96.77;  Ed  0, 0
ans =

    ' IL_42771.1  6JQ5 U   34 A   60'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.41, deficit  1.61, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UUA*UUA (   1) MLPS  -4.81 deficit   0.31 prct   0.00 CutScore  96.77;  Ed  0, 0
ans =

    ' IL_42771.1  6JQ6 U   34 A   60'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.41, deficit  1.61, prct   0.00; 
Group 338 is from IL_82107.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_82107.4
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UG*UAAA (   1) MLPS  -4.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82107.4  5J7L U 1841 A 1901'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UG*UAAA (   1) MLPS  -4.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82107.4  8CRE U 2178 A 2222'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UG*UAAA (   1) MLPS  -4.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82107.4  8P9A U 2200 A 2244'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UG*UAAA (   1) MLPS  -4.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82107.4  4WF9 U 1868 A 1928'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00              UG*UAAA (   1) MLPS  -4.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_82107.4  1NBS U  181 A  231'

 matches the original group, cWW-cWW
Better:   2 Equal:   0 Score 0.00              AG*CAAU (   1) MLPS  -4.62 deficit   0.13 prct   0.00 CutScore  98.61;  Ed  0, 0
ans =

    ' IL_82107.4  5W1H A  -23 U   -4'

 scores better against   2 groups: IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.06, deficit  0.13, prct   0.00; IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -4.32, deficit  1.06, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AG*CAAU (   1) MLPS  -4.62 deficit   0.13 prct   0.00 CutScore  98.61;  Ed  0, 0
ans =

    ' IL_82107.4  5WLH A  -23 U   -4'

 scores better against   2 groups: IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.06, deficit  0.13, prct   0.00; IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -4.32, deficit  1.06, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              CG*UAAG (   1) MLPS  -4.65 deficit   0.15 prct   0.00 CutScore  98.38;  Ed  0, 0
ans =

    ' IL_82107.4  4YAZ C   68 G   50'

 matches the original group, cWW-cWW
Better:   5 Equal:   0 Score 0.00              UG*CAAA (   1) MLPS  -4.70 deficit   0.20 prct   0.00 CutScore  97.86;  Ed  0, 0
ans =

    ' IL_82107.4  1U9S U  116 A  227'

 scores better against   5 groups: IL_02555.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -3.39, deficit  1.08, prct   0.00; IL_14368.1,  6 NTs, cWW-L-cWW-cSH                           , Ed  1, 1, MLPS -3.71, deficit  1.30, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.07, deficit  0.14, prct   0.00; IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  1, 1, MLPS -4.33, deficit  0.83, prct   0.00; IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  2, 0, MLPS -4.51, deficit  1.24, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AC*GAAU (   1) MLPS  -4.79 deficit   0.29 prct   0.00 CutScore  96.91;  Ed  0, 0
ans =

    ' IL_82107.4  5M0H A   35 U   11'

 scores better against   2 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  0, 0, MLPS -3.46, deficit  0.20, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -4.18, deficit  0.25, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              GG*UAGC (   1) MLPS  -5.72 deficit   1.23 prct   0.00 CutScore  87.07;  Ed  0, 0
ans =

    ' IL_82107.4  3MXH G   56 C   84'

 scores better against   2 groups: IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -3.42, deficit  0.06, prct   0.00; IL_95583.2,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.95, deficit  1.11, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              GG*UAGC (   1) MLPS  -5.72 deficit   1.23 prct   0.00 CutScore  87.07;  Ed  0, 0
ans =

    ' IL_82107.4  3IWN G   46 C   79'

 scores better against   2 groups: IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -3.42, deficit  0.06, prct   0.00; IL_95583.2,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.95, deficit  1.11, prct   0.00; 
Better:   8 Equal:   0 Score 0.00              CG*CUAG (   1) MLPS  -5.89 deficit   1.40 prct   0.00 CutScore  85.30;  Ed  0, 0
ans =

    ' IL_82107.4  8SP9 C  106 G   79'

 scores better against   8 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.60, deficit  1.34, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.72, deficit  0.56, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.56, deficit  0.75, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -5.57, deficit  0.00, prct   0.00; IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -5.58, deficit  1.64, prct   0.00; 
Better:   8 Equal:   0 Score 0.00              CG*CAUG (   1) MLPS  -5.89 deficit   1.40 prct   0.00 CutScore  85.30;  Ed  0, 0
ans =

    ' IL_82107.4  4V9F C  726 G  702'

 scores better against   8 groups: IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -3.09, deficit  0.23, prct   0.00; IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  3, 0, MLPS -4.60, deficit  0.16, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -5.21, deficit  0.19, prct   0.00; IL_95583.2,  5 NTs, cWW-L-cWW                               , Ed  2, 1, MLPS -5.39, deficit  1.55, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -5.66, deficit  1.73, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              GG*CAGC (   1) MLPS  -5.92 deficit   1.43 prct   0.00 CutScore  84.93;  Ed  0, 0
ans =

    ' IL_82107.4  4YAZ G   51 C   67'

 scores better against   4 groups: IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  0, 0, MLPS -4.41, deficit  0.33, prct   0.00; IL_95583.2,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -4.44, deficit  0.60, prct   0.00; IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -4.97, deficit  1.60, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -5.54, deficit  1.61, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              UG*CGAA (   1) MLPS  -5.93 deficit   1.43 prct   0.00 CutScore  84.91;  Ed  0, 0
ans =

    ' IL_82107.4  5J7L U  103 A   66'

 scores better against   3 groups: IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  0, 0, MLPS -4.19, deficit  0.69, prct   0.00; IL_14368.1,  6 NTs, cWW-L-cWW-cSH                           , Ed  1, 1, MLPS -4.81, deficit  2.40, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -5.68, deficit  1.75, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UG*UCAA (   1) MLPS  -5.96 deficit   1.47 prct   0.00 CutScore  84.56;  Ed  0, 0
ans =

    ' IL_82107.4  4V9F U 1897 A 1942'

 scores better against   1 groups: IL_95583.2,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -5.43, deficit  1.59, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              AC*GACU (   1) MLPS  -6.25 deficit   1.76 prct   0.00 CutScore  81.48;  Ed  0, 0
ans =

    ' IL_82107.4  5WTK A    3 U   23'

 scores better against   4 groups: IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -5.03, deficit  0.00, prct   0.00; IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -5.05, deficit  0.61, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  3, 0, MLPS -5.64, deficit  0.79, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -5.79, deficit  1.85, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              AC*GACU (   1) MLPS  -6.25 deficit   1.76 prct   0.00 CutScore  81.48;  Ed  0, 0
ans =

    ' IL_82107.4  7OS0 A   11 U   32'

 scores better against   4 groups: IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -5.03, deficit  0.00, prct   0.00; IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -5.05, deficit  0.61, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  3, 0, MLPS -5.64, deficit  0.79, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -5.79, deficit  1.85, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              AC*GACU (   1) MLPS  -6.25 deficit   1.76 prct   0.00 CutScore  81.48;  Ed  0, 0
ans =

    ' IL_82107.4  5XWP A    5 U   25'

 scores better against   4 groups: IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -5.03, deficit  0.00, prct   0.00; IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -5.05, deficit  0.61, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  3, 0, MLPS -5.64, deficit  0.79, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -5.79, deficit  1.85, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              GG*UUUC (   1) MLPS  -6.57 deficit   2.08 prct   0.00 CutScore  78.15;  Ed  0, 0
ans =

    ' IL_82107.4  1FUF G   23 C    8'

 scores better against   3 groups: IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -5.78, deficit  1.05, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -6.38, deficit  2.22, prct   0.00; IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  3, 2, MLPS -6.47, deficit  3.10, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              GG*UUUC (   1) MLPS  -6.57 deficit   2.08 prct   0.00 CutScore  78.15;  Ed  0, 0
ans =

    ' IL_82107.4  1FUF G    9 C   22'

 scores better against   3 groups: IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -5.78, deficit  1.05, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -6.38, deficit  2.22, prct   0.00; IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  3, 2, MLPS -6.47, deficit  3.10, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              GG*UUUC (   1) MLPS  -6.57 deficit   2.08 prct   0.00 CutScore  78.15;  Ed  0, 0
ans =

    ' IL_82107.4  8CRE G 1619 C 1818'

 scores better against   3 groups: IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -5.78, deficit  1.05, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -6.38, deficit  2.22, prct   0.00; IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  3, 2, MLPS -6.47, deficit  3.10, prct   0.00; 
Better:   6 Equal:   0 Score 0.00              CG*CGUG (   1) MLPS  -7.12 deficit   2.63 prct   0.00 CutScore  72.36;  Ed  0, 0
ans =

    ' IL_82107.4  4LFB C  103 G   66'

 scores better against   6 groups: IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  4, 1, MLPS -4.70, deficit  1.84, prct   0.00; IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -5.37, deficit  0.65, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -6.15, deficit  1.99, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -6.31, deficit  1.29, prct   0.00; IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -6.79, deficit  2.36, prct   0.00; 
Better:  10 Equal:   0 Score 0.00              AC*GUCU (   1) MLPS  -7.29 deficit   2.80 prct   0.00 CutScore  70.54;  Ed  0, 0
ans =

    ' IL_82107.4  6IV9 A  -29 U   -6'

 scores better against  10 groups: IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -5.03, deficit  0.00, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.83, deficit  1.67, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -6.54, deficit  1.69, prct   0.00; IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -6.65, deficit  2.57, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -6.68, deficit  1.87, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              AA*UCGU (   1) MLPS  -7.44 deficit   2.94 prct   0.00 CutScore  69.01;  Ed  0, 0
ans =

    ' IL_82107.4  8CRE A  298 U  116'

 scores better against   5 groups: IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  2, 1, MLPS -5.60, deficit  1.52, prct   0.00; IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -7.18, deficit  3.23, prct   0.00; IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 1, MLPS -7.25, deficit  3.88, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 2, MLPS -7.37, deficit  2.34, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  6, 2, MLPS -7.41, deficit  3.47, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              AA*UCGU (   1) MLPS  -7.44 deficit   2.94 prct   0.00 CutScore  69.01;  Ed  0, 0
ans =

    ' IL_82107.4  8P9A A  300 U  116'

 scores better against   5 groups: IL_15052.4,  6 NTs, cWW-L-cWW-L                             , Ed  2, 1, MLPS -5.60, deficit  1.52, prct   0.00; IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -7.18, deficit  3.23, prct   0.00; IL_47074.2,  6 NTs, cWW-L-cWW-L                             , Ed  2, 1, MLPS -7.25, deficit  3.88, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 2, MLPS -7.37, deficit  2.34, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  6, 2, MLPS -7.41, deficit  3.47, prct   0.00; 
Better:   9 Equal:   0 Score 0.00             GAA*UAGC (   1) MLPS  -8.91 deficit   4.42 prct   0.00 CutScore  53.45;  Ed  0, 0
ans =

    ' IL_82107.4  7JJU G   36 C    9'

 scores better against   9 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -5.90, deficit  0.32, prct   0.00; IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  4, 1, MLPS -6.96, deficit  2.11, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.97, deficit  2.06, prct   0.00; IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -7.34, deficit  3.91, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  1, 1, MLPS -7.76, deficit  2.05, prct   0.00; 
Better:   9 Equal:   0 Score 0.00             GAA*UAGC (   1) MLPS  -8.91 deficit   4.42 prct   0.00 CutScore  53.45;  Ed  0, 0
ans =

    ' IL_82107.4  7JJU G   36 C    9'

 scores better against   9 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -5.90, deficit  0.32, prct   0.00; IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  4, 1, MLPS -6.96, deficit  2.11, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.97, deficit  2.06, prct   0.00; IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -7.34, deficit  3.91, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  1, 1, MLPS -7.76, deficit  2.05, prct   0.00; 
Better:  16 Equal:   0 Score 0.00              ACU*AUU (   1) MLPS -12.15 deficit   7.66 prct   0.00 CutScore  19.37;  Ed  0, 0
ans =

    ' IL_82107.4  9DID A   15 U   74'

 scores better against  16 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.02, deficit  0.05, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -6.07, deficit  2.31, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -6.17, deficit  1.04, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.52, deficit  0.50, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -6.75, deficit  3.95, prct   0.00; 
Group 347 is from IL_83389.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_83389.2
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             AAG*CUAU (   1) MLPS  -5.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_83389.2  4V9F A 2095 U 2650'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00             ACG*CUAU (   1) MLPS  -6.05 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0
ans =

    ' IL_83389.2  4WF9 A 2081 U 2642'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00             ACG*CUAU (   1) MLPS  -6.05 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0
ans =

    ' IL_83389.2  5J7L A 2054 U 2615'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00             GAA*UACC (   1) MLPS  -6.15 deficit   0.44 prct   0.00 CutScore  95.41;  Ed  0, 0
ans =

    ' IL_83389.2  8P9A G 2396 C 2984'

 matches the original group, cWW-cWW
Better:   0 Equal:   0 Score 1.00             GAA*UACC (   1) MLPS  -6.15 deficit   0.44 prct   0.00 CutScore  95.41;  Ed  0, 0
ans =

    ' IL_83389.2  8CRE G 2374 C 2956'

 matches the original group, cWW-cWW
Group 350 is from IL_84476.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_84476.1
This group is considered to be unstructured ---------------------------
Number of NTs:  4  Signature: cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00              CC*GUUG (   1) MLPS  -4.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_84476.1  8P9A C 3349 G 3356'

 scores better against   1 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.15, deficit -0.01, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CC*GUUG (   1) MLPS  -4.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_84476.1  8CRE C 3314 G 3321'

 scores better against   1 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.15, deficit -0.01, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CC*GUUG (   1) MLPS  -4.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_84476.1  7D3J C   11 G   19'

 scores better against   1 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.15, deficit -0.01, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CC*GUUG (   1) MLPS  -4.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_84476.1  7EU9 C   11 G   19'

 scores better against   1 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.15, deficit -0.01, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CU*AUUG (   1) MLPS  -4.54 deficit   0.27 prct   0.00 CutScore  97.20;  Ed  0, 0
ans =

    ' IL_84476.1  6LTU C   11 G   19'

 scores better against   1 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.28, deficit  0.12, prct   0.00; 
Better:   6 Equal:   0 Score 0.00              CG*CUAG (   1) MLPS  -5.71 deficit   1.43 prct   0.00 CutScore  84.96;  Ed  0, 0
ans =

    ' IL_84476.1  8ZAU C   11 G   41'

 scores better against   6 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.60, deficit  1.34, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.72, deficit  0.56, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.56, deficit  0.75, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -5.57, deficit  0.00, prct   0.00; IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -5.58, deficit  1.64, prct   0.00; 
Better:   6 Equal:   0 Score 0.00              CG*CUAG (   1) MLPS  -5.71 deficit   1.43 prct   0.00 CutScore  84.96;  Ed  0, 0
ans =

    ' IL_84476.1  7Q80 C   13 G   38'

 scores better against   6 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.60, deficit  1.34, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.72, deficit  0.56, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.56, deficit  0.75, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -5.57, deficit  0.00, prct   0.00; IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -5.58, deficit  1.64, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              AC*GAUU (   1) MLPS  -5.97 deficit   1.69 prct   0.00 CutScore  82.20;  Ed  0, 0
ans =

    ' IL_84476.1  6JXM A   34 U   56'

 scores better against   5 groups: IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  3, 0, MLPS -4.54, deficit  0.10, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  0, 0, MLPS -5.03, deficit  0.00, prct   0.00; IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  1, 0, MLPS -5.37, deficit  1.88, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  5, 1, MLPS -5.79, deficit  1.85, prct   0.00; IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  1, 0, MLPS -5.82, deficit  1.33, prct   0.00; 
Better:  11 Equal:   0 Score 0.00              GCUC*GC (   1) MLPS  -7.54 deficit   3.26 prct   0.00 CutScore  65.69;  Ed  0, 0
ans =

    ' IL_84476.1  3R2D G    2 C   11'

 scores better against  11 groups: IL_59877.1,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -4.47, deficit  1.61, prct   0.00; IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -5.56, deficit  1.61, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 1, MLPS -6.10, deficit  1.94, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 1, MLPS -6.13, deficit  1.10, prct   0.00; IL_42626.2,  4 NTs, cWW-cWW                                 , Ed  3, 0, MLPS -6.52, deficit  1.67, prct   0.00; 
Better:   6 Equal:   0 Score 0.00              CUAG*CG (   1) MLPS  -7.72 deficit   3.44 prct   0.00 CutScore  63.78;  Ed  0, 0
ans =

    ' IL_84476.1  7Q80 C   35 G   14'

 scores better against   6 groups: IL_68140.4,  6 NTs, cWW-cSH-cWW                             , Ed  1, 0, MLPS -4.60, deficit  1.34, prct   0.00; IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.72, deficit  0.56, prct   0.00; IL_81831.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -5.56, deficit  0.75, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -5.57, deficit  0.00, prct   0.00; IL_22551.4,  6 NTs, cWW-L-cWW-L                             , Ed  4, 1, MLPS -5.58, deficit  1.64, prct   0.00; 
Better:   3 Equal:   0 Score 0.00             GUUCG*CC (   1) MLPS  -8.79 deficit   4.51 prct   0.00 CutScore  52.55;  Ed  0, 0
ans =

    ' IL_84476.1  1R3E G  408 C  416'

 scores better against   3 groups: IL_94967.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -6.41, deficit  1.17, prct   0.00; IL_47078.3,  7 NTs, cWW-cWS-L-cWW-L                         , Ed  5, 2, MLPS -7.76, deficit  2.37, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  3, 2, MLPS -8.49, deficit  2.92, prct   0.00; 
Better:   3 Equal:   0 Score 0.00             GUUCG*CC (   1) MLPS  -8.79 deficit   4.51 prct   0.00 CutScore  52.55;  Ed  0, 0
ans =

    ' IL_84476.1  1R3E G  408 C  416'

 scores better against   3 groups: IL_94967.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -6.41, deficit  1.17, prct   0.00; IL_47078.3,  7 NTs, cWW-cWS-L-cWW-L                         , Ed  5, 2, MLPS -7.76, deficit  2.37, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  3, 2, MLPS -8.49, deficit  2.92, prct   0.00; 
Better:  20 Equal:   0 Score 0.00              CGAC*GG (   1) MLPS  -9.11 deficit   4.83 prct   0.00 CutScore  49.17;  Ed  0, 0
ans =

    ' IL_84476.1  4ERD C  120 G  147'

 scores better against  20 groups: IL_50694.7,  6 NTs, cWW-tSH-cWW-L                           , Ed  0, 0, MLPS -3.50, deficit  0.00, prct   0.00; IL_02555.1,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -4.05, deficit  1.75, prct   0.00; IL_33761.2,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -5.15, deficit  1.36, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -5.54, deficit  1.61, prct   0.00; IL_82107.4,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -5.92, deficit  1.43, prct   0.00; 
Group 236 is from IL_59049.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_59049.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-cWW-L-R-L-R-L-R-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   GAAAAAAUU*AUAUUAGC (   1) MLPS  -8.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_59049.1  8P9A G  751 C  798'

 matches the original group, cWW-cWW-L-R-L-R-L-R-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00   GAAAAAAUU*AUAUUAGC (   1) MLPS  -8.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_59049.1  8CRE G  736 C  782'

 matches the original group, cWW-cWW-L-R-L-R-L-R-L-R-L-cWW-L
Group  19 is from IL_04600.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_04600.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cWW-L-R-L-R-L-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UCGAAAA*UCGAAAA (   1) MLPS  -8.67 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04600.1  5XWG U    9 A   15'

 matches the original group, cWW-cWW-L-R-L-R-L-R-cWW-cWW
Group 149 is from IL_36729.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_36729.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-cWW-L-R-L-R-L-R-tWH-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00   GAGCCCAAC*GGCUAGAC (   1) MLPS -11.83 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_36729.1  8Z8U G    6 C   36'

 scores better against   1 groups: IL_21630.1, 17 NTs, cWW-L-R-L-R-L-R-cSH-R-tWH-R-cWW-cWW     , Ed  0, 0, MLPS -11.62, deficit  0.00, prct   0.00; 
Group 336 is from IL_81731.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_81731.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-cWW-L-R-L-R-L-cWW-L-tWW-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   GGCUAAAGAGUG*CAGAC (   1) MLPS -11.62 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_81731.1  4M6D G   12 C   48'

 matches the original group, cWW-cWW-L-R-L-R-L-cWW-L-tWW-L-R-L
Group 244 is from IL_61242.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_61242.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cWW-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CUGUG*CUGUG (   1) MLPS  -5.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61242.1  4Z31 C    6 G   10'

 matches the original group, cWW-cWW-L-R-L-R-cWW
Group 201 is from IL_49867.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_49867.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-cWW-L-R-L-R-tHW-R-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CAAUACUC*GUGCCGG (   1) MLPS  -7.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_49867.1  1YLS C  228 G  217'

 matches the original group, cWW-cWW-L-R-L-R-tHW-R-L-L-cWW
Group 253 is from IL_62012.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_62012.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           AAAAG*CGCU (   1) MLPS  -6.38 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_62012.1  2O3Y A   38 U   10'

 matches the original group, cWW-cWW-L-R-L-cWW
Group 259 is from IL_64231.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_64231.5
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CUAAC*GGUG (   1) MLPS  -6.68 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_64231.5  5J7L C 2870 G 2846'

 matches the original group, cWW-cWW-L-R-L-cWW
Better:   1 Equal:   0 Score 0.00           CUACC*GAUG (   1) MLPS  -6.82 deficit   0.14 prct   0.00 CutScore  98.54;  Ed  0, 0
ans =

    ' IL_64231.5  4LFB C  132 G  230'

 scores better against   1 groups: IL_53448.1,  8 NTs, cWW-tWH-cSH-cWW                         , Ed  2, 0, MLPS -6.82, deficit  2.80, prct   0.00; 
Better:   2 Equal:   0 Score 0.00           AAAAG*CGCU (   1) MLPS  -7.09 deficit   0.41 prct   0.00 CutScore  95.81;  Ed  0, 0
ans =

    ' IL_64231.5  2O3V A   38 U   10'

 scores better against   2 groups: IL_62012.1,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  0, 0, MLPS -6.38, deficit  0.00, prct   0.00; IL_51479.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -6.99, deficit  0.00, prct   0.00; 
Better:   2 Equal:   0 Score 0.00           AAAAG*CGCU (   1) MLPS  -7.09 deficit   0.41 prct   0.00 CutScore  95.81;  Ed  0, 0
ans =

    ' IL_64231.5  8P9A A 1753 U 1647'

 scores better against   2 groups: IL_62012.1,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  0, 0, MLPS -6.38, deficit  0.00, prct   0.00; IL_51479.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -6.99, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           GCAAG*CACC (   1) MLPS  -7.64 deficit   0.96 prct   0.00 CutScore  90.21;  Ed  0, 0
ans =

    ' IL_64231.5  3BNT G   14 C    9'

 scores better against   1 groups: IL_71598.1,  8 NTs, cWW-tSH-L-cWW-L                         , Ed  4, 2, MLPS -6.50, deficit  0.28, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           GCAAG*CACC (   1) MLPS  -7.64 deficit   0.96 prct   0.00 CutScore  90.21;  Ed  0, 0
ans =

    ' IL_64231.5  3BNR G   13 C   10'

 scores better against   1 groups: IL_71598.1,  8 NTs, cWW-tSH-L-cWW-L                         , Ed  4, 2, MLPS -6.50, deficit  0.28, prct   0.00; 
Better:   0 Equal:   0 Score 1.00           CUGCC*GAUG (   1) MLPS  -8.56 deficit   1.88 prct   0.00 CutScore  80.88;  Ed  0, 0
ans =

    ' IL_64231.5  5J7L C  132 G  230'

 matches the original group, cWW-cWW-L-R-L-cWW
Better:   3 Equal:   0 Score 0.00           GUAAC*GCCC (   1) MLPS  -8.73 deficit   2.05 prct   0.00 CutScore  79.11;  Ed  0, 0
ans =

    ' IL_64231.5  3LOA G 1497 C 1404'

 scores better against   3 groups: IL_65718.4,  9 NTs, cWW-cSH-cWS-cWW-cWW                     , Ed  0, 0, MLPS -5.71, deficit  0.00, prct   0.00; IL_66997.2,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  4, 2, MLPS -7.32, deficit  1.43, prct   0.00; IL_71598.1,  8 NTs, cWW-tSH-L-cWW-L                         , Ed  5, 3, MLPS -7.62, deficit  1.40, prct   0.00; 
Better:   2 Equal:   0 Score 0.00           CAAGC*GAAG (   1) MLPS  -9.59 deficit   2.91 prct   0.00 CutScore  70.35;  Ed  0, 0
ans =

    ' IL_64231.5  1U6B C   96 G  122'

 scores better against   2 groups: IL_58112.2,  8 NTs, cWW-cWW-L-R-cWW                         , Ed  2, 2, MLPS -7.56, deficit  0.49, prct   0.00; IL_48444.6,  8 NTs, cWW-L-R-cWW-cWW                         , Ed  4, 2, MLPS -9.49, deficit  1.68, prct   0.00; 
Better:   0 Equal:   0 Score 1.00           CCCAC*GUUG (   1) MLPS -10.47 deficit   3.79 prct   0.00 CutScore  61.42;  Ed  0, 0
ans =

    ' IL_64231.5  8VMA C   22 G   19'

 matches the original group, cWW-cWW-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           UUUCU*GAAA (   1) MLPS -11.62 deficit   4.94 prct   0.00 CutScore  49.65;  Ed  0, 0
ans =

    ' IL_64231.5  1HYS U  880 A  874'

 matches the original group, cWW-cWW-L-R-L-cWW
Group 399 is from IL_96332.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_96332.5
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cWW-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GACGGUC*GGGC (   1) MLPS  -6.82 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_96332.5  8K85 G    4 C   53'

 matches the original group, cWW-cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00         GACGGUC*GGGC (   1) MLPS  -6.82 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_96332.5  8K85 G    4 C   53'

 matches the original group, cWW-cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00         GACGGUC*GGGC (   1) MLPS  -6.82 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_96332.5  8K7W G    3 C   47'

 matches the original group, cWW-cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00         GAAGGAC*GAGC (   1) MLPS  -6.95 deficit   0.13 prct   0.00 CutScore  99.25;  Ed  0, 0
ans =

    ' IL_96332.5  4TS2 G   22 C   77'

 matches the original group, cWW-cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00         GAAGGAC*GAGC (   1) MLPS  -6.95 deficit   0.13 prct   0.00 CutScore  99.25;  Ed  0, 0
ans =

    ' IL_96332.5  4KZD G   19 C   66'

 matches the original group, cWW-cWW-L-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00         GAGGGUC*GGGC (   1) MLPS  -8.43 deficit   1.61 prct   0.00 CutScore  90.58;  Ed  0, 0
ans =

    ' IL_96332.5  7L0Z G   12 C   58'

 matches the original group, cWW-cWW-L-R-L-cWW-L
Better:   7 Equal:   0 Score 0.00          CCCAGG*CAAG (   1) MLPS -13.46 deficit   6.64 prct   0.00 CutScore  61.09;  Ed  0, 0
ans =

    ' IL_96332.5  3NPQ C   26 G   19'

 scores better against   7 groups: IL_69145.3, 10 NTs, cWW-L-cWW-L-R-L-R-R                     , Ed  5, 1, MLPS -7.33, deficit  3.10, prct   0.00; IL_45444.1,  9 NTs, cWW-L-R-L-R-L-cWW                       , Ed  4, 2, MLPS -8.62, deficit  3.34, prct   0.00; IL_34737.1,  9 NTs, cWW-L-cHW-L-cWW-L                       , Ed  5, 3, MLPS -8.91, deficit  2.45, prct   0.00; IL_75294.1,  9 NTs, cWW-L-R-L-R-L-cWW                       , Ed  3, 1, MLPS -9.01, deficit  1.10, prct   0.00; IL_90346.1,  9 NTs, cWW-L-R-L-cWW-L-L                       , Ed  4, 2, MLPS -9.18, deficit  2.27, prct   0.00; 
Group 284 is from IL_69271.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_69271.3
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-cWW-L-R-L-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CUGACGGAAG*CAUG (   1) MLPS  -7.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69271.3  9BZC C   12 G   36'

 matches the original group, cWW-cWW-L-R-L-cWW-L-L-R
Better:   0 Equal:   0 Score 1.00     CUGACGGAACG*CAUG (   1) MLPS  -9.46 deficit   1.54 prct   0.00 CutScore  92.30;  Ed  0, 0
ans =

    ' IL_69271.3  5BTP C   15 G   41'

 matches the original group, cWW-cWW-L-R-L-cWW-L-L-R
Group 242 is from IL_60657.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_60657.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-cWW-L-R-L-cWW-L-L-R-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    CUGGCGGAUUAG*CGUG (   1) MLPS -10.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_60657.1  4ZNP C   12 G   37'

 matches the original group, cWW-cWW-L-R-L-cWW-L-L-R-L-R-L-R
Group 120 is from IL_29198.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_29198.2
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cWW-L-R-cSH-R-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GAGGUAA*UAAAUAU (   1) MLPS  -7.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_29198.2  8P9A G  991 U 1058'

 matches the original group, cWW-cWW-L-R-cSH-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00      GAGGUAA*UAAAUAU (   1) MLPS  -7.51 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_29198.2  8CRE G  987 U 1054'

 matches the original group, cWW-cWW-L-R-cSH-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00      GAGGUAG*CGAAUGC (   1) MLPS  -8.49 deficit   0.99 prct   0.00 CutScore  95.07;  Ed  0, 0
ans =

    ' IL_29198.2  4WF9 G  901 C  966'

 matches the original group, cWW-cWW-L-R-cSH-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00      GGGGUAG*CGAAUAC (   1) MLPS  -8.52 deficit   1.01 prct   0.00 CutScore  94.93;  Ed  0, 0
ans =

    ' IL_29198.2  5J7L G  856 C  921'

 matches the original group, cWW-cWW-L-R-cSH-R-tWH-tHS-cWW
Group 255 is from IL_63519.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_63519.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-cWW-L-R-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GAUAC*GCAGC (   1) MLPS  -6.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_63519.1  8D28 G    4 C   30'

 matches the original group, cWW-cWW-L-R-cSH-cWW
Better:   0 Equal:   0 Score 1.00          GAUAC*GCAGC (   1) MLPS  -6.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_63519.1  8DK7 G    4 C   31'

 matches the original group, cWW-cWW-L-R-cSH-cWW
Group 175 is from IL_43644.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_43644.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AAUG*CCUU (   1) MLPS  -5.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_43644.1  5J7L A 2183 U 2106'

 matches the original group, cWW-cWW-L-R-cWW
Better:   0 Equal:   0 Score 1.00            CCCG*CCCG (   1) MLPS  -6.41 deficit   0.80 prct   0.00 CutScore  92.83;  Ed  0, 0
ans =

    ' IL_43644.1  5EW4 C    8 G   17'

 matches the original group, cWW-cWW-L-R-cWW
Group 232 is from IL_58112.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_58112.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   2 Equal:   0 Score 0.00           GGGC*GGUAC (   1) MLPS  -7.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_58112.2  4PMI G   46 C   74'

 scores better against   2 groups: IL_25872.4,  8 NTs, cWW-cWW-cWH-cWW                         , Ed  0, 0, MLPS -6.08, deficit  0.08, prct   0.00; IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  3, 1, MLPS -6.49, deficit  1.78, prct   0.00; 
Better:   0 Equal:   0 Score 1.00           GAAG*CCUGC (   1) MLPS  -7.22 deficit   0.15 prct   0.00 CutScore  98.47;  Ed  0, 0
ans =

    ' IL_58112.2  5J7L G 1432 C 1561'

 matches the original group, cWW-cWW-L-R-cWW
Better:   1 Equal:   0 Score 0.00           GGAC*GAAAC (   1) MLPS  -7.41 deficit   0.34 prct   0.00 CutScore  96.46;  Ed  0, 0
ans =

    ' IL_58112.2  6CF2 G    5 C   31'

 scores better against   1 groups: IL_66997.2,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  3, 1, MLPS -7.37, deficit  1.48, prct   0.00; 
Better:   2 Equal:   0 Score 0.00          UUUCC*GACAA (   1) MLPS -11.67 deficit   4.60 prct   0.00 CutScore  52.77;  Ed  0, 0
ans =

    ' IL_58112.2  6MDZ U    9 A   13'

 scores better against   2 groups: IL_67780.1, 10 NTs, cWW-cSH-L-R-L-L-R-L                     , Ed  6, 2, MLPS -8.46, deficit  1.58, prct   0.00; IL_74367.1, 10 NTs, cWW-L-R-L-R-L-R-cWW                     , Ed  6, 2, MLPS -9.28, deficit  4.03, prct   0.00; 
Group  52 is from IL_12697.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_12697.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cWW-L-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UCAAA*UGACAA (   1) MLPS  -7.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_12697.1  8CRE U   37 A  469'

 matches the original group, cWW-cWW-L-R-tHS-cWW
Better:   0 Equal:   0 Score 1.00         UCAAA*UGACAA (   1) MLPS  -7.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_12697.1  8P9A U   37 A  471'

 matches the original group, cWW-cWW-L-R-tHS-cWW
Group 294 is from IL_70801.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70801.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cWW-L-R-tWW-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CAUUGAC*GAAGGG (   1) MLPS  -6.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70801.1  5J7L C  477 G  455'

 matches the original group, cWW-cWW-L-R-tWW-L-R-L-cWW
Group  81 is from IL_19668.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_19668.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           AGAUGC*GAU (   1) MLPS  -7.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_19668.1  3E5C A   27 U   14'

 matches the original group, cWW-cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00           AAGGAA*UGU (   1) MLPS  -7.66 deficit   0.00 prct   0.00 CutScore  99.99;  Ed  0, 0
ans =

    ' IL_19668.1  6E8U A    6 U   32'

 matches the original group, cWW-cWW-L-cWW-L
Group 174 is from IL_43622.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_43622.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UUAAGC*GUA (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_43622.1  8P9A U 3373 A 3330'

 matches the original group, cWW-cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00           UUAAGC*GUA (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_43622.1  8CRE U 3338 A 3295'

 matches the original group, cWW-cWW-L-cWW-L
Group 187 is from IL_46387.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_46387.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GUUCU*ACC (   1) MLPS  -6.05 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_46387.1  9DID G    9 C   78'

 matches the original group, cWW-cWW-L-cWW-L
Better:   1 Equal:   0 Score 0.00            CCAAU*AUG (   1) MLPS  -6.61 deficit   0.56 prct   0.00 CutScore  94.17;  Ed  0, 0
ans =

    ' IL_46387.1  2OEU C   14 G    5'

 scores better against   1 groups: IL_63596.11,  7 NTs, cWW-cWS-cSH-tWH-cWW-L                   , Ed  1, 1, MLPS -6.05, deficit  2.69, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            GGUGG*CGC (   1) MLPS  -7.84 deficit   1.79 prct   0.00 CutScore  81.50;  Ed  0, 0
ans =

    ' IL_46387.1  7D81 G   33 C   24'

 scores better against   1 groups: IL_42314.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  5, 1, MLPS -7.04, deficit  1.28, prct   0.00; 
Group  74 is from IL_17973.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_17973.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-cWW-L-cWW-L-L-R-L-R-L-R-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CAAGCGGGGUGGCACC*GCGG (   1) MLPS -14.11 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_17973.1  6UFG C  116 G   99'

 matches the original group, cWW-cWW-L-cWW-L-L-R-L-R-L-R-L-R-L-R
Group  21 is from IL_04650.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_04650.2
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cWW-L-cWW-L-R-L-L-cSH
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        AACAACCCCG*CU (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04650.2  6TFF A    7 U   46'

 matches the original group, cWW-cWW-L-cWW-L-R-L-L-cSH
Better:   0 Equal:   0 Score 1.00        AACAACCCCG*CU (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04650.2  7D7W A    7 U   46'

 matches the original group, cWW-cWW-L-cWW-L-R-L-L-cSH
Better:   0 Equal:   0 Score 1.00        AACAUCCCCG*CU (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04650.2  7D7V A    6 U   53'

 matches the original group, cWW-cWW-L-cWW-L-R-L-L-cSH
Better:   0 Equal:   0 Score 1.00        AACAUCCCCG*CU (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04650.2  7D81 A    7 U   44'

 matches the original group, cWW-cWW-L-cWW-L-R-L-L-cSH
Group 313 is from IL_76460.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_76460.1
This group is considered to be structured ***************************
Number of NTs: 22  Signature: cWW-cWW-L-tHS-L-R-L-cWW-L-L-R-L-L-R-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CUCAGACCCGAAGCGUG*CGGUG (   1) MLPS -12.33 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_76460.1  6R47 C   28 G   63'

 matches the original group, cWW-cWW-L-tHS-L-R-L-cWW-L-L-R-L-L-R-L-R-L-R
Group 124 is from IL_29471.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_29471.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cWW-L-tHS-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CUGAAG*CGUG (   1) MLPS  -6.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_29471.1  5J7L C 2806 G 2892'

 matches the original group, cWW-cWW-L-tHS-L-cWW
Group 386 is from IL_92446.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_92446.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cWW-R-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CAUC*GUUG (   1) MLPS  -4.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_92446.2  1MMS C 1076 G 1062'

 matches the original group, cWW-cWW-R-L-L
Better:   0 Equal:   0 Score 1.00            CAUC*GUUG (   1) MLPS  -4.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_92446.2  5D8H C 1186 G 1172'

 matches the original group, cWW-cWW-R-L-L
Better:   0 Equal:   0 Score 1.00            CAUC*GUUG (   1) MLPS  -4.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_92446.2  6PRV C 1076 G 1062'

 matches the original group, cWW-cWW-R-L-L
Better:   0 Equal:   0 Score 1.00            CAUC*GUUG (   1) MLPS  -4.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_92446.2  5J7L C 1076 G 1062'

 matches the original group, cWW-cWW-R-L-L
Better:   0 Equal:   0 Score 1.00            UACC*GUGA (   1) MLPS  -6.57 deficit   2.35 prct   0.00 CutScore  78.77;  Ed  0, 0
ans =

    ' IL_92446.2  4V9F U 1180 A 1166'

 matches the original group, cWW-cWW-R-L-L
Group 221 is from IL_55516.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_55516.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-cWW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             GCGG*UAC (   1) MLPS  -5.62 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_55516.2  8CRE G 2369 C 2960'

 matches the original group, cWW-cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00             GCGG*UAC (   1) MLPS  -5.62 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_55516.2  8P9A G 2391 C 2988'

 matches the original group, cWW-cWW-cSH-cWW
Better:   0 Equal:   0 Score 1.00             GCAC*GAC (   1) MLPS  -6.11 deficit   0.49 prct   0.00 CutScore  94.82;  Ed  0, 0
ans =

    ' IL_55516.2  7SZU G   49 C   27'

 matches the original group, cWW-cWW-cSH-cWW
Better:   6 Equal:   0 Score 0.00             GAAG*CAC (   1) MLPS  -6.53 deficit   0.91 prct   0.00 CutScore  90.42;  Ed  0, 0
ans =

    ' IL_55516.2  6DME G   33 C   22'

 scores better against   6 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.58, deficit  0.67, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -5.59, deficit -0.13, prct   0.00; IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -5.65, deficit  0.07, prct   0.00; IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  0, 0, MLPS -6.27, deficit  1.44, prct   0.00; 
Better:   2 Equal:   0 Score 0.00             GGGG*UAC (   1) MLPS  -6.56 deficit   0.94 prct   0.00 CutScore  90.13;  Ed  0, 0
ans =

    ' IL_55516.2  4V9F G 2090 C 2654'

 scores better against   2 groups: IL_96371.1,  6 NTs, cWW-tHH-cWW                             , Ed  2, 0, MLPS -4.34, deficit  0.07, prct   0.00; IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  2, 0, MLPS -5.29, deficit  0.43, prct   0.00; 
Better:   3 Equal:   0 Score 0.00            GUAAA*UGC (   1) MLPS  -8.17 deficit   2.56 prct   0.00 CutScore  73.10;  Ed  0, 0
ans =

    ' IL_55516.2  2A64 G  237 C  193'

 scores better against   3 groups: IL_66997.2,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  4, 2, MLPS -5.60, deficit -0.28, prct   0.00; IL_06549.2,  4 NTs, cWW-cWW                                 , Ed  5, 2, MLPS -6.47, deficit  0.45, prct   0.00; IL_63596.11,  7 NTs, cWW-cWS-cSH-tWH-cWW-L                   , Ed  3, 1, MLPS -7.98, deficit  4.62, prct   0.00; 
Better:   3 Equal:   0 Score 0.00           GAACAA*UAC (   1) MLPS  -9.73 deficit   4.11 prct   0.00 CutScore  56.73;  Ed  0, 0
ans =

    ' IL_55516.2  3DD2 G    3 C   23'

 scores better against   3 groups: IL_98347.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 1, MLPS -7.85, deficit  1.10, prct   0.00; IL_33323.1,  9 NTs, cWW-L-R-L-cWW-L-L                       , Ed  6, 2, MLPS -8.10, deficit  1.62, prct   0.00; IL_59302.1,  9 NTs, cWW-L-R-L-cWW-L                         , Ed  5, 1, MLPS -8.30, deficit  1.88, prct   0.00; 
Group 148 is from IL_36516.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_36516.3
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-cSH-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GAAUG*CGC (   1) MLPS  -6.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_36516.3  8P9A G 2206 C 2237'

 matches the original group, cWW-cWW-cSH-cWW-L
Better:   0 Equal:   0 Score 1.00            AAUCU*ACU (   1) MLPS  -6.40 deficit   0.13 prct   0.00 CutScore  98.58;  Ed  0, 0
ans =

    ' IL_36516.3  7EL1 A   42 U   31'

 matches the original group, cWW-cWW-cSH-cWW-L
Better:   0 Equal:   0 Score 1.00            AAUCU*ACU (   1) MLPS  -6.40 deficit   0.13 prct   0.00 CutScore  98.58;  Ed  0, 0
ans =

    ' IL_36516.3  7ENI A   42 U   31'

 matches the original group, cWW-cWW-cSH-cWW-L
Better:   1 Equal:   0 Score 0.00            GGAUC*GAC (   1) MLPS  -6.66 deficit   0.39 prct   0.00 CutScore  95.86;  Ed  0, 0
ans =

    ' IL_36516.3  6DME G   15 C   39'

 scores better against   1 groups: IL_47972.1,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  4, 0, MLPS -5.51, deficit  0.15, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            GGUUC*GAC (   1) MLPS  -6.83 deficit   0.57 prct   0.00 CutScore  94.04;  Ed  0, 0
ans =

    ' IL_36516.3  6CK5 G   16 C   44'

 scores better against   1 groups: IL_47972.1,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  5, 1, MLPS -6.61, deficit  1.25, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            AAGCU*ACU (   1) MLPS  -6.91 deficit   0.65 prct   0.00 CutScore  93.21;  Ed  0, 0
ans =

    ' IL_36516.3  6M0X A   38 U   31'

 matches the original group, cWW-cWW-cSH-cWW-L
Better:   0 Equal:   0 Score 1.00            CAGUG*CAG (   1) MLPS  -7.17 deficit   0.91 prct   0.00 CutScore  90.47;  Ed  0, 0
ans =

    ' IL_36516.3  4PDB C    9 G   30'

 matches the original group, cWW-cWW-cSH-cWW-L
Group 107 is from IL_25872.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25872.4
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-cWH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GAGA*UGGU (   1) MLPS  -6.00 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_25872.4  7WIE G   49 U   13'

 matches the original group, cWW-cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00           GGGC*GGUAC (   1) MLPS  -6.08 deficit   0.08 prct   0.00 CutScore  99.16;  Ed  0, 0
ans =

    ' IL_25872.4  1CSL G   46 C   74'

 matches the original group, cWW-cWW-cWH-cWW
Better:   0 Equal:   0 Score 1.00           GGGC*GGUAC (   1) MLPS  -6.08 deficit   0.08 prct   0.00 CutScore  99.16;  Ed  0, 0
ans =

    ' IL_25872.4  1DUQ G  104 C  127'

 matches the original group, cWW-cWW-cWH-cWW
Better:   1 Equal:   0 Score 0.00            CGGG*CGGG (   1) MLPS  -7.42 deficit   1.41 prct   0.00 CutScore  85.13;  Ed  0, 0
ans =

    ' IL_25872.4  7R9F C    5 G    8'

 scores better against   1 groups: IL_04785.1,  8 NTs, cWW-L-R-L-R-cWW                         , Ed  4, 2, MLPS -6.14, deficit -0.59, prct   0.00; 
Better:   3 Equal:   0 Score 0.00            AAAC*GCAU (   1) MLPS  -8.70 deficit   2.70 prct   0.00 CutScore  71.59;  Ed  0, 0
ans =

    ' IL_25872.4  6DTD A   31 U    8'

 scores better against   3 groups: IL_80398.1,  8 NTs, cWW-L-cSW-L-R-cWW                       , Ed  3, 1, MLPS -6.56, deficit  1.29, prct   0.00; IL_04785.1,  8 NTs, cWW-L-R-L-R-cWW                         , Ed  5, 3, MLPS -6.59, deficit -0.14, prct   0.00; IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  2, 1, MLPS -7.84, deficit  2.77, prct   0.00; 
Group 130 is from IL_31504.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_31504.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-cWW-cWS-tSH-L-tWH-cWW-tSS-tSH-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GAGGCGAAAUAGAGC*GUACC (   1) MLPS  -9.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_31504.1  4V9F G  501 C  491'

 matches the original group, cWW-cWW-cWS-tSH-L-tWH-cWW-tSS-tSH-L-R-L
Group  35 is from IL_07785.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_07785.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   2 Equal:   0 Score 0.00              GUG*CUC (   1) MLPS  -5.14 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07785.1  4V83 G 6173 C 6155'

 scores better against   2 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.21, deficit  0.41, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -3.90, deficit  0.14, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UUG*CUG (   1) MLPS  -5.21 deficit   0.08 prct   0.00 CutScore  99.20;  Ed  0, 0
ans =

    ' IL_07785.1  8CRE U 1483 G 1498'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.98, deficit  2.19, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AUA*UUU (   1) MLPS  -5.36 deficit   0.22 prct   0.00 CutScore  97.67;  Ed  0, 0
ans =

    ' IL_07785.1  4Y1M A  103 U    6'

 scores better against   2 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.76, deficit  0.96, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -4.92, deficit  0.41, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UUA*UUG (   1) MLPS  -5.43 deficit   0.29 prct   0.00 CutScore  96.92;  Ed  0, 0
ans =

    ' IL_07785.1  8CRE U 1652 G 1723'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.30, deficit  2.50, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UUA*UUG (   1) MLPS  -5.43 deficit   0.29 prct   0.00 CutScore  96.92;  Ed  0, 0
ans =

    ' IL_07785.1  8P9A U 1665 G 1736'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.30, deficit  2.50, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              UUU*AUA (   1) MLPS  -5.44 deficit   0.31 prct   0.00 CutScore  96.76;  Ed  0, 0
ans =

    ' IL_07785.1  8P9A U  429 A  630'

 scores better against   2 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.76, deficit  0.96, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -4.92, deficit  0.41, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              AUG*CCU (   1) MLPS  -5.90 deficit   0.76 prct   0.00 CutScore  91.95;  Ed  0, 0
ans =

    ' IL_07785.1  7A0S A  584 U  575'

 scores better against   1 groups: IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.44, deficit  1.68, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              AUG*CCU (   1) MLPS  -5.90 deficit   0.76 prct   0.00 CutScore  91.95;  Ed  0, 0
ans =

    ' IL_07785.1  9DFE A  575 U  566'

 scores better against   1 groups: IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.44, deficit  1.68, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              AUG*CCU (   1) MLPS  -5.90 deficit   0.76 prct   0.00 CutScore  91.95;  Ed  0, 0
ans =

    ' IL_07785.1  5J7L A  575 U  566'

 scores better against   1 groups: IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.44, deficit  1.68, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              AUG*CCU (   1) MLPS  -5.90 deficit   0.76 prct   0.00 CutScore  91.95;  Ed  0, 0
ans =

    ' IL_07785.1  4WF9 A  618 U  609'

 scores better against   1 groups: IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.44, deficit  1.68, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UUG*UUG (   1) MLPS  -6.72 deficit   1.58 prct   0.00 CutScore  83.37;  Ed  0, 0
ans =

    ' IL_07785.1  4KYY U    8 G   10'

 scores better against   1 groups: IL_10796.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 2, MLPS -5.79, deficit  2.20, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UUG*UUG (   1) MLPS  -6.72 deficit   1.58 prct   0.00 CutScore  83.37;  Ed  0, 0
ans =

    ' IL_07785.1  4WF9 U  705 G  640'

 scores better against   1 groups: IL_10796.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 2, MLPS -5.79, deficit  2.20, prct   0.00; 
Better:   0 Equal:   0 Score 1.00             GUU*AUAC (   1) MLPS  -7.12 deficit   1.99 prct   0.00 CutScore  79.07;  Ed  0, 0
ans =

    ' IL_07785.1  4PKD G  106 C   89'

 matches the original group, cWW-cWW-cWW
Better:   2 Equal:   0 Score 0.00              UCG*CCG (   1) MLPS  -7.17 deficit   2.04 prct   0.00 CutScore  78.57;  Ed  0, 0
ans =

    ' IL_07785.1  7A0S U   82 G   99'

 scores better against   2 groups: IL_10796.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 0, MLPS -5.68, deficit  2.08, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -6.97, deficit  3.21, prct   0.00; 
Better:   6 Equal:   0 Score 0.00             CAC*GCAG (   1) MLPS  -7.18 deficit   2.04 prct   0.00 CutScore  78.48;  Ed  0, 0
ans =

    ' IL_07785.1  7A0S C   19 G   69'

 scores better against   6 groups: IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  1, 0, MLPS -6.13, deficit  0.52, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -6.37, deficit  0.66, prct   0.00; IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 1, MLPS -6.56, deficit  3.14, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -6.82, deficit  1.91, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 1, MLPS -7.00, deficit  0.00, prct   0.00; 
Better:   4 Equal:   0 Score 0.00             GAG*CCAC (   1) MLPS  -7.27 deficit   2.14 prct   0.00 CutScore  77.51;  Ed  0, 0
ans =

    ' IL_07785.1  7DLZ G   12 C   36'

 scores better against   4 groups: IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  3, 1, MLPS -6.10, deficit  0.39, prct   0.00; IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  2, 0, MLPS -6.42, deficit  0.80, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  5, 1, MLPS -7.15, deficit  0.15, prct   0.00; IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -7.22, deficit  3.79, prct   0.00; 
Better:   7 Equal:   0 Score 0.00             GAC*GCAC (   1) MLPS  -7.27 deficit   2.14 prct   0.00 CutScore  77.49;  Ed  0, 0
ans =

    ' IL_07785.1  4V9F G 2855 C 2903'

 scores better against   7 groups: IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  0, 0, MLPS -6.11, deficit  0.49, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  4, 1, MLPS -6.26, deficit  0.54, prct   0.00; IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -6.78, deficit  3.35, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -7.07, deficit  0.07, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -7.11, deficit  2.20, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              ACU*ACU (   1) MLPS  -7.37 deficit   2.24 prct   0.00 CutScore  76.46;  Ed  0, 0
ans =

    ' IL_07785.1  7QQP A   12 U    9'

 scores better against   2 groups: IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.78, deficit  2.02, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -7.07, deficit  4.27, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            CUC*GUGAG (   1) MLPS  -7.50 deficit   2.36 prct   0.00 CutScore  75.14;  Ed  0, 0
ans =

    ' IL_07785.1  8CRE C 2851 G 2919'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUC*GUGAG (   1) MLPS  -7.50 deficit   2.36 prct   0.00 CutScore  75.14;  Ed  0, 0
ans =

    ' IL_07785.1  8P9A C 2879 G 2947'

 matches the original group, cWW-cWW-cWW
Better:   3 Equal:   0 Score 0.00             UAA*UCGA (   1) MLPS  -7.62 deficit   2.48 prct   0.00 CutScore  73.89;  Ed  0, 0
ans =

    ' IL_07785.1  8CRE U   64 A   96'

 scores better against   3 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -6.33, deficit  0.75, prct   0.00; IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  3, 1, MLPS -6.66, deficit  1.80, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  1, 1, MLPS -6.77, deficit  2.60, prct   0.00; 
Better:   3 Equal:   0 Score 0.00             UAA*UCGA (   1) MLPS  -7.62 deficit   2.48 prct   0.00 CutScore  73.89;  Ed  0, 0
ans =

    ' IL_07785.1  8P9A U   64 A   96'

 scores better against   3 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -6.33, deficit  0.75, prct   0.00; IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  3, 1, MLPS -6.66, deficit  1.80, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  1, 1, MLPS -6.77, deficit  2.60, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            UUC*GUGAG (   1) MLPS  -7.67 deficit   2.53 prct   0.00 CutScore  73.36;  Ed  0, 0
ans =

    ' IL_07785.1  4V9F U 2545 G 2613'

 matches the original group, cWW-cWW-cWW
Better:   2 Equal:   0 Score 0.00             GUUG*CUC (   1) MLPS  -7.83 deficit   2.70 prct   0.00 CutScore  71.62;  Ed  0, 0
ans =

    ' IL_07785.1  5B2P G   28 C   46'

 scores better against   2 groups: IL_51387.2,  7 NTs, cWW-cSH-cWW-cWW                         , Ed  0, 0, MLPS -5.33, deficit  0.38, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -7.14, deficit  0.10, prct   0.00; 
Better:   2 Equal:   0 Score 0.00             UUUG*CUG (   1) MLPS  -7.91 deficit   2.77 prct   0.00 CutScore  70.83;  Ed  0, 0
ans =

    ' IL_07785.1  8CRE U 1394 G 1408'

 scores better against   2 groups: IL_51387.2,  7 NTs, cWW-cSH-cWW-cWW                         , Ed  2, 0, MLPS -6.72, deficit  1.77, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 1, MLPS -7.66, deficit  0.62, prct   0.00; 
Better:   2 Equal:   0 Score 0.00             GUUU*AUC (   1) MLPS  -8.10 deficit   2.97 prct   0.00 CutScore  68.76;  Ed  0, 0
ans =

    ' IL_07785.1  8P9A G  819 C  852'

 scores better against   2 groups: IL_51387.2,  7 NTs, cWW-cSH-cWW-cWW                         , Ed  1, 0, MLPS -5.34, deficit  0.39, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 1, MLPS -7.39, deficit  0.34, prct   0.00; 
Better:   2 Equal:   0 Score 0.00            CUC*GCGAG (   1) MLPS  -8.26 deficit   3.12 prct   0.00 CutScore  67.13;  Ed  0, 0
ans =

    ' IL_07785.1  4WF9 C 2537 G 2605'

 scores better against   2 groups: IL_46387.1,  8 NTs, cWW-cWW-L-cWW-L                         , Ed  4, 1, MLPS -7.72, deficit  1.67, prct   0.00; IL_44325.1,  6 NTs, cWW-cWH-cWW-L                           , Ed  2, 2, MLPS -8.02, deficit  2.20, prct   0.00; 
Better:   2 Equal:   0 Score 0.00            CUC*GCGAG (   1) MLPS  -8.26 deficit   3.12 prct   0.00 CutScore  67.13;  Ed  0, 0
ans =

    ' IL_07785.1  9DFE C 2510 G 2578'

 scores better against   2 groups: IL_46387.1,  8 NTs, cWW-cWW-L-cWW-L                         , Ed  4, 1, MLPS -7.72, deficit  1.67, prct   0.00; IL_44325.1,  6 NTs, cWW-cWH-cWW-L                           , Ed  2, 2, MLPS -8.02, deficit  2.20, prct   0.00; 
Better:   2 Equal:   0 Score 0.00            CUC*GCGAG (   1) MLPS  -8.26 deficit   3.12 prct   0.00 CutScore  67.13;  Ed  0, 0
ans =

    ' IL_07785.1  7A0S C 2489 G 2557'

 scores better against   2 groups: IL_46387.1,  8 NTs, cWW-cWW-L-cWW-L                         , Ed  4, 1, MLPS -7.72, deficit  1.67, prct   0.00; IL_44325.1,  6 NTs, cWW-cWH-cWW-L                           , Ed  2, 2, MLPS -8.02, deficit  2.20, prct   0.00; 
Better:   2 Equal:   0 Score 0.00            CUC*GCGAG (   1) MLPS  -8.26 deficit   3.12 prct   0.00 CutScore  67.13;  Ed  0, 0
ans =

    ' IL_07785.1  5J7L C 2510 G 2578'

 scores better against   2 groups: IL_46387.1,  8 NTs, cWW-cWW-L-cWW-L                         , Ed  4, 1, MLPS -7.72, deficit  1.67, prct   0.00; IL_44325.1,  6 NTs, cWW-cWH-cWW-L                           , Ed  2, 2, MLPS -8.02, deficit  2.20, prct   0.00; 
Better:   7 Equal:   0 Score 0.00             UAC*GCCA (   1) MLPS  -8.83 deficit   3.70 prct   0.00 CutScore  61.06;  Ed  0, 0
ans =

    ' IL_07785.1  5ML7 U 2181 A 2199'

 scores better against   7 groups: IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  2, 1, MLPS -6.07, deficit  0.45, prct   0.00; IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -7.17, deficit  1.45, prct   0.00; IL_09990.4,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -7.95, deficit  3.50, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 1, MLPS -8.07, deficit  3.89, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  4, 2, MLPS -8.08, deficit  2.06, prct   0.00; 
Better:   3 Equal:   0 Score 0.00            CAG*CCCGG (   1) MLPS  -9.44 deficit   4.31 prct   0.00 CutScore  54.66;  Ed  0, 0
ans =

    ' IL_07785.1  7ELQ C   15 G   36'

 scores better against   3 groups: IL_19102.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 1, MLPS -6.76, deficit  0.40, prct   0.00; IL_10389.1,  8 NTs, cWW-L-cWW-L-cWW                         , Ed  2, 1, MLPS -8.00, deficit  1.10, prct   0.00; IL_44325.1,  6 NTs, cWW-cWH-cWW-L                           , Ed  4, 2, MLPS -8.09, deficit  2.27, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            UUAUC*GUG (   1) MLPS -10.56 deficit   5.42 prct   0.00 CutScore  42.95;  Ed  0, 0
ans =

    ' IL_07785.1  8P9A U 1369 G 1354'

 scores better against   4 groups: IL_89984.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  5, 1, MLPS -8.97, deficit  3.96, prct   0.00; IL_36516.3,  8 NTs, cWW-cWW-cSH-cWW-L                       , Ed  4, 2, MLPS -9.30, deficit  3.04, prct   0.00; IL_06549.2,  4 NTs, cWW-cWW                                 , Ed  2, 2, MLPS -9.52, deficit  3.51, prct   0.00; IL_51387.2,  7 NTs, cWW-cSH-cWW-cWW                         , Ed  2, 1, MLPS -9.56, deficit  4.61, prct   0.00; 
Group  60 is from IL_14688.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_14688.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UUU*ACA (   1) MLPS  -5.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_14688.1  8P9A U 1249 A 1236'

 matches the original group, cWW-cWW-cWW
Better:   2 Equal:   0 Score 0.00              ACC*GUU (   1) MLPS  -6.05 deficit   0.08 prct   0.00 CutScore  99.20;  Ed  0, 0
ans =

    ' IL_14688.1  6RTI A    4 U   40'

 scores better against   2 groups: IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.58, deficit  1.81, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -5.96, deficit  3.16, prct   0.00; 
Better:   0 Equal:   0 Score 1.00             GGU*AUAC (   1) MLPS  -6.38 deficit   0.41 prct   0.00 CutScore  95.68;  Ed  0, 0
ans =

    ' IL_14688.1  8F4O G   18 C   48'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GGU*AUAC (   1) MLPS  -6.38 deficit   0.41 prct   0.00 CutScore  95.68;  Ed  0, 0
ans =

    ' IL_14688.1  7TZS G   18 C   48'

 matches the original group, cWW-cWW-cWW
Better:   1 Equal:   0 Score 0.00             UAC*GACG (   1) MLPS  -8.39 deficit   2.41 prct   0.00 CutScore  74.60;  Ed  0, 0
ans =

    ' IL_14688.1  7A0S U 1447 G 1576'

 scores better against   1 groups: IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 1, MLPS -8.36, deficit  2.34, prct   0.00; 
Group 116 is from IL_28037.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_28037.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  3BNN G   17 C    5'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  3BNR G   19 C    5'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  2O3Y G   28 C   21'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  2OE8 G 1494 C 1407'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  3BNN G    3 C   19'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  2O3Y G    5 C   44'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  4K31 G    5 C   21'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  4K31 G    5 C   21'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  2OE5 G 1494 C 1407'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  3TD0 G   28 C   21'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  3BNR G    5 C   19'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  3LOA G 1494 C 1407'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  2O3V G    5 C   44'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  2O3V G   28 C   21'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  5WTI G   10 C   20'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  3TD0 G   42 C    7'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  4P3U G   28 C   21'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  3BNT G    4 C   20'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  1ZX7 G   10 C   26'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  4P3U G   42 C    7'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  5T3K G   10 C   26'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  2ET8 G   27 C   20'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  4LFB G 1061 C 1195'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  2O3X G   28 C   21'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  1T0E G   10 C   16'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GUC (   1) MLPS  -2.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28037.2  5J7L G 1061 C 1195'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUC*GUU (   1) MLPS  -2.98 deficit   0.18 prct   0.00 CutScore  98.14;  Ed  0, 0
ans =

    ' IL_28037.2  4KYY A   11 U    7'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUC*GUU (   1) MLPS  -2.98 deficit   0.18 prct   0.00 CutScore  98.14;  Ed  0, 0
ans =

    ' IL_28037.2  1MFQ A  228 U  122'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUC*GUU (   1) MLPS  -2.98 deficit   0.18 prct   0.00 CutScore  98.14;  Ed  0, 0
ans =

    ' IL_28037.2  4KYY A   11 U    7'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUC*GUU (   1) MLPS  -2.98 deficit   0.18 prct   0.00 CutScore  98.14;  Ed  0, 0
ans =

    ' IL_28037.2  5ZTM A  123 U  159'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUC*GUU (   1) MLPS  -2.98 deficit   0.18 prct   0.00 CutScore  98.14;  Ed  0, 0
ans =

    ' IL_28037.2  1L9A A  228 U  122'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUG*CUC (   1) MLPS  -3.21 deficit   0.41 prct   0.00 CutScore  95.66;  Ed  0, 0
ans =

    ' IL_28037.2  4V9F G 1349 C 1305'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUG*CUC (   1) MLPS  -3.21 deficit   0.41 prct   0.00 CutScore  95.66;  Ed  0, 0
ans =

    ' IL_28037.2  7L0Z G   10 C   60'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUG*CUC (   1) MLPS  -3.21 deficit   0.41 prct   0.00 CutScore  95.66;  Ed  0, 0
ans =

    ' IL_28037.2  4KZD G   17 C   68'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUC*GUG (   1) MLPS  -3.31 deficit   0.51 prct   0.00 CutScore  94.60;  Ed  0, 0
ans =

    ' IL_28037.2  4TS2 C   77 G   22'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*CUU (   1) MLPS  -3.39 deficit   0.59 prct   0.00 CutScore  93.80;  Ed  0, 0
ans =

    ' IL_28037.2  3U4M A 2108 U 2181'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*CUU (   1) MLPS  -3.39 deficit   0.59 prct   0.00 CutScore  93.80;  Ed  0, 0
ans =

    ' IL_28037.2  7XPL A    6 U   24'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*CUU (   1) MLPS  -3.39 deficit   0.59 prct   0.00 CutScore  93.80;  Ed  0, 0
ans =

    ' IL_28037.2  1MZP A    4 U   52'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*CUU (   1) MLPS  -3.39 deficit   0.59 prct   0.00 CutScore  93.80;  Ed  0, 0
ans =

    ' IL_28037.2  1U6B A  117 U  102'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*CUU (   1) MLPS  -3.39 deficit   0.59 prct   0.00 CutScore  93.80;  Ed  0, 0
ans =

    ' IL_28037.2  3RG5 A   5B U  67A'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*CUU (   1) MLPS  -3.39 deficit   0.59 prct   0.00 CutScore  93.80;  Ed  0, 0
ans =

    ' IL_28037.2  7QQX A   11 U   10'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*CUU (   1) MLPS  -3.39 deficit   0.59 prct   0.00 CutScore  93.80;  Ed  0, 0
ans =

    ' IL_28037.2  8G9Z A   5B U  67A'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUA*UUC (   1) MLPS  -3.58 deficit   0.78 prct   0.00 CutScore  91.74;  Ed  0, 0
ans =

    ' IL_28037.2  8FEQ G    4 C   13'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UUC*GUA (   1) MLPS  -3.63 deficit   0.83 prct   0.00 CutScore  91.29;  Ed  0, 0
ans =

    ' IL_28037.2  5B2P U   24 A   50'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CUG (   1) MLPS  -3.73 deficit   0.93 prct   0.00 CutScore  90.26;  Ed  0, 0
ans =

    ' IL_28037.2  4JGN C  517 G  507'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CUG (   1) MLPS  -3.73 deficit   0.93 prct   0.00 CutScore  90.26;  Ed  0, 0
ans =

    ' IL_28037.2  6E7L C    4 G   19'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CUG (   1) MLPS  -3.73 deficit   0.93 prct   0.00 CutScore  90.26;  Ed  0, 0
ans =

    ' IL_28037.2  5MWI C   23 G    4'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CUG (   1) MLPS  -3.73 deficit   0.93 prct   0.00 CutScore  90.26;  Ed  0, 0
ans =

    ' IL_28037.2  4PCJ C   33 G    3'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CUG (   1) MLPS  -3.73 deficit   0.93 prct   0.00 CutScore  90.26;  Ed  0, 0
ans =

    ' IL_28037.2  5VCI C   10 G    3'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUA*UUU (   1) MLPS  -3.76 deficit   0.96 prct   0.00 CutScore  89.89;  Ed  0, 0
ans =

    ' IL_28037.2  8P9A A  965 U  956'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUA*UUU (   1) MLPS  -3.76 deficit   0.96 prct   0.00 CutScore  89.89;  Ed  0, 0
ans =

    ' IL_28037.2  8CRE A  961 U  952'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUA*UUU (   1) MLPS  -3.76 deficit   0.96 prct   0.00 CutScore  89.89;  Ed  0, 0
ans =

    ' IL_28037.2  8P9A A 3168 U 3282'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUU*AUU (   1) MLPS  -3.77 deficit   0.97 prct   0.00 CutScore  89.76;  Ed  0, 0
ans =

    ' IL_28037.2  8CRE A 2984 U 3014'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUU*AUU (   1) MLPS  -3.77 deficit   0.97 prct   0.00 CutScore  89.76;  Ed  0, 0
ans =

    ' IL_28037.2  8P9A A 3012 U 3042'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              UUA*UUA (   1) MLPS  -4.41 deficit   1.61 prct   0.00 CutScore  83.03;  Ed  0, 0
ans =

    ' IL_28037.2  6SX2 U    9 A   11'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*UUU (   1) MLPS  -4.65 deficit   1.85 prct   0.00 CutScore  80.54;  Ed  0, 0
ans =

    ' IL_28037.2  8CRE A  783 U  735'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AUG*UUU (   1) MLPS  -4.65 deficit   1.85 prct   0.00 CutScore  80.54;  Ed  0, 0
ans =

    ' IL_28037.2  8P9A A  799 U  750'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*UUG (   1) MLPS  -4.98 deficit   2.19 prct   0.00 CutScore  77.00;  Ed  0, 0
ans =

    ' IL_28037.2  5J7L C 2232 G 2087'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*UUG (   1) MLPS  -4.98 deficit   2.19 prct   0.00 CutScore  77.00;  Ed  0, 0
ans =

    ' IL_28037.2  7A0S C 2068 G 2213'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*UUG (   1) MLPS  -4.98 deficit   2.19 prct   0.00 CutScore  77.00;  Ed  0, 0
ans =

    ' IL_28037.2  9DFE C 2085 G 2234'

 matches the original group, cWW-cWW-cWW
Better:   1 Equal:   0 Score 0.00              ACC*GUU (   1) MLPS  -5.96 deficit   3.16 prct   0.00 CutScore  66.76;  Ed  0, 0
ans =

    ' IL_28037.2  9DID A   76 U   11'

 scores better against   1 groups: IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.58, deficit  1.81, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              UUU*AUG (   1) MLPS  -6.13 deficit   3.33 prct   0.00 CutScore  64.94;  Ed  0, 0
ans =

    ' IL_28037.2  5J7L U  870 G  907'

 matches the original group, cWW-cWW-cWW
Better:   4 Equal:   0 Score 0.00              ACU*AUU (   1) MLPS  -6.75 deficit   3.95 prct   0.00 CutScore  58.37;  Ed  0, 0
ans =

    ' IL_28037.2  8CRE A  255 U  206'

 scores better against   4 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.02, deficit  0.05, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -6.07, deficit  2.31, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -6.17, deficit  1.04, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.52, deficit  0.50, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              AUU*ACU (   1) MLPS  -6.96 deficit   4.16 prct   0.00 CutScore  56.18;  Ed  0, 0
ans =

    ' IL_28037.2  8P9A A  206 U  259'

 scores better against   4 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.02, deficit  0.05, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -6.07, deficit  2.31, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -6.17, deficit  1.04, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.52, deficit  0.50, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              CCG*CCG (   1) MLPS  -7.03 deficit   4.23 prct   0.00 CutScore  55.52;  Ed  0, 0
ans =

    ' IL_28037.2  4KNQ C  216 G  206'

 scores better against   3 groups: IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.42, deficit  0.65, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 1, MLPS -6.96, deficit  3.98, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -7.00, deficit  1.87, prct   0.00; 
Group 183 is from IL_45896.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_45896.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CAGUAAUAUG*CUUACAAAAUGG (   1) MLPS -18.92 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_45896.1  3IAB C   64 G   99'

 matches the original group, cWW-cWW-cWW
Group 229 is from IL_57744.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_57744.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00             GAAG*CGC (   1) MLPS  -4.91 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_57744.1  3TD0 G   16 C   32'

 scores better against   1 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 1, MLPS -4.82, deficit -0.75, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             GAAG*CGC (   1) MLPS  -4.91 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_57744.1  3TD0 G   39 C    9'

 scores better against   1 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 1, MLPS -4.82, deficit -0.75, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             GAAA*UGC (   1) MLPS  -5.28 deficit   0.37 prct   0.00 CutScore  96.07;  Ed  0, 0
ans =

    ' IL_57744.1  5J7L G  128 C  233'

 scores better against   1 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -5.12, deficit -0.45, prct   0.00; 
Better:   0 Equal:   0 Score 1.00             AAAG*CGU (   1) MLPS  -5.32 deficit   0.41 prct   0.00 CutScore  95.65;  Ed  0, 0
ans =

    ' IL_57744.1  4K31 A   16 U    9'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             AAAG*CGU (   1) MLPS  -5.32 deficit   0.41 prct   0.00 CutScore  95.65;  Ed  0, 0
ans =

    ' IL_57744.1  4K31 A   16 U    9'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GAUG*CGC (   1) MLPS  -5.35 deficit   0.44 prct   0.00 CutScore  95.42;  Ed  0, 0
ans =

    ' IL_57744.1  9DFE G 1031 C 1123'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GAUG*CGC (   1) MLPS  -5.35 deficit   0.44 prct   0.00 CutScore  95.42;  Ed  0, 0
ans =

    ' IL_57744.1  5J7L G 1031 C 1123'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GAUG*CGC (   1) MLPS  -5.35 deficit   0.44 prct   0.00 CutScore  95.42;  Ed  0, 0
ans =

    ' IL_57744.1  4WF9 G 1075 C 1167'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             GAUG*CGC (   1) MLPS  -5.35 deficit   0.44 prct   0.00 CutScore  95.42;  Ed  0, 0
ans =

    ' IL_57744.1  7A0S G 1042 C 1134'

 matches the original group, cWW-cWW-cWW
Better:   1 Equal:   0 Score 0.00             GAAG*CAC (   1) MLPS  -5.58 deficit   0.67 prct   0.00 CutScore  92.96;  Ed  0, 0
ans =

    ' IL_57744.1  5T3K G    7 C   28'

 scores better against   1 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             GAAG*CAC (   1) MLPS  -5.58 deficit   0.67 prct   0.00 CutScore  92.96;  Ed  0, 0
ans =

    ' IL_57744.1  2QEK G    7 C   17'

 scores better against   1 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  0, 0, MLPS -3.43, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             CGAC*GAG (   1) MLPS  -5.76 deficit   0.85 prct   0.00 CutScore  91.05;  Ed  0, 0
ans =

    ' IL_57744.1  7LYF C   51 G   72'

 scores better against   1 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 0, MLPS -5.61, deficit  2.18, prct   0.00; 
Better:   0 Equal:   0 Score 1.00             CAGC*GGG (   1) MLPS  -6.07 deficit   1.16 prct   0.00 CutScore  87.78;  Ed  0, 0
ans =

    ' IL_57744.1  6TFF C   34 G   25'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00             CAGC*GGG (   1) MLPS  -6.07 deficit   1.16 prct   0.00 CutScore  87.78;  Ed  0, 0
ans =

    ' IL_57744.1  7D7W C   34 G   25'

 matches the original group, cWW-cWW-cWW
Better:   4 Equal:   0 Score 0.00              GGA*UAC (   1) MLPS  -6.25 deficit   1.34 prct   0.00 CutScore  85.93;  Ed  0, 0
ans =

    ' IL_57744.1  6WBR G   26 C   43'

 scores better against   4 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 0, MLPS -5.22, deficit  1.24, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  0, 0, MLPS -5.57, deficit  2.59, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 2, MLPS -5.60, deficit -0.37, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.76, deficit  1.99, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             GAGC*GAC (   1) MLPS  -6.50 deficit   1.59 prct   0.00 CutScore  83.25;  Ed  0, 0
ans =

    ' IL_57744.1  4RUM G   13 C   90'

 scores better against   1 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -4.96, deficit -0.61, prct   0.00; 
Better:   6 Equal:   0 Score 0.00              UAU*AAA (   1) MLPS  -7.11 deficit   2.20 prct   0.00 CutScore  76.82;  Ed  0, 0
ans =

    ' IL_57744.1  7QR8 U   14 A    6'

 scores better against   6 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  3, 0, MLPS -5.16, deficit  0.33, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  1, 0, MLPS -5.49, deficit  1.02, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 1, MLPS -5.61, deficit -0.41, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -5.77, deficit -0.20, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  3, 1, MLPS -5.83, deficit  1.65, prct   0.00; 
Better:   0 Equal:   0 Score 1.00             CAGU*GGG (   1) MLPS  -7.15 deficit   2.24 prct   0.00 CutScore  76.40;  Ed  0, 0
ans =

    ' IL_57744.1  7D7V C   41 G   24'

 matches the original group, cWW-cWW-cWW
Better:   8 Equal:   0 Score 0.00              CAG*UAG (   1) MLPS  -7.80 deficit   2.89 prct   0.00 CutScore  69.60;  Ed  0, 0
ans =

    ' IL_57744.1  5UNE C   27 G   18'

 scores better against   8 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -6.18, deficit  1.34, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -6.56, deficit  0.59, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  1, 1, MLPS -6.70, deficit  2.52, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  0, 0, MLPS -7.36, deficit  4.38, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  1, 0, MLPS -7.44, deficit  2.97, prct   0.00; 
Better:   7 Equal:   0 Score 0.00             GCCG*CAC (   1) MLPS  -8.56 deficit   3.64 prct   0.00 CutScore  61.64;  Ed  0, 0
ans =

    ' IL_57744.1  1U6B G   19 C   31'

 scores better against   7 groups: IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  5, 1, MLPS -7.16, deficit  1.44, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 2, MLPS -7.93, deficit  1.91, prct   0.00; IL_09990.4,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -7.94, deficit  3.49, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 0, MLPS -8.06, deficit  1.02, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 2, MLPS -8.10, deficit  1.10, prct   0.00; 
Better:  11 Equal:   0 Score 0.00              CCG*UAG (   1) MLPS  -9.04 deficit   4.13 prct   0.00 CutScore  56.54;  Ed  0, 0
ans =

    ' IL_57744.1  5ZTM C  162 G  120'

 scores better against  11 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  1, 0, MLPS -5.13, deficit  0.95, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -5.63, deficit  0.50, prct   0.00; IL_87907.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -6.43, deficit  2.66, prct   0.00; IL_10796.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 1, MLPS -6.77, deficit  3.18, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -7.07, deficit  4.27, prct   0.00; 
Better:   2 Equal:   0 Score 0.00             GUUU*GAC (   1) MLPS  -9.12 deficit   4.21 prct   0.00 CutScore  55.69;  Ed  0, 0
ans =

    ' IL_57744.1  8P9A G  957 C  870'

 scores better against   2 groups: IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  4, 1, MLPS -8.02, deficit  2.31, prct   0.00; IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 1, MLPS -9.03, deficit  4.19, prct   0.00; 
Group 366 is from IL_87907.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_87907.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  4JGN C  514 G  510'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  3GM7 C    1 G   18'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  5VCI C    4 G    9'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  3SZX C    7 G   15'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  4E48 C   31 G   10'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  3GM7 C    1 G   18'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  3GM7 C   13 G    6'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  5MWI C    8 G   19'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  4E48 C   25 G   16'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  3SZX C   10 G   12'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  5MWI C    5 G   22'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  3GM7 C    4 G   15'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  4E48 C    5 G   36'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  5MWI C   11 G   16'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  3GM7 C    7 G   12'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  3SZX C   13 G    9'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  1ZH5 C    3 G    5'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  4JGN C  511 G  513'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  4E48 C   11 G   30'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  4E48 C   37 G    4'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  4E48 C   17 G   24'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  3GM7 C    7 G   12'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  7Y2P C    3 G   11'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  1UN6 C   95 G   81'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CUG*CUG (   1) MLPS  -3.76 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87907.2  7Y2P C    3 G   11'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -3.73, deficit  0.93, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              CAG*CCG (   1) MLPS  -3.87 deficit   0.11 prct   0.00 CutScore  98.84;  Ed  0, 0
ans =

    ' IL_87907.2  4V9F C   72 G  109'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAG*CCG (   1) MLPS  -3.87 deficit   0.11 prct   0.00 CutScore  98.84;  Ed  0, 0
ans =

    ' IL_87907.2  4V9K C   50 G   64'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAC*GCG (   1) MLPS  -4.01 deficit   0.25 prct   0.00 CutScore  97.36;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE C 3134 G 3251'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAC*GCG (   1) MLPS  -4.01 deficit   0.25 prct   0.00 CutScore  97.36;  Ed  0, 0
ans =

    ' IL_87907.2  1U9S C  191 G  179'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAC*GCG (   1) MLPS  -4.01 deficit   0.25 prct   0.00 CutScore  97.36;  Ed  0, 0
ans =

    ' IL_87907.2  4WF9 C 1160 G 1083'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAC*GCG (   1) MLPS  -4.01 deficit   0.25 prct   0.00 CutScore  97.36;  Ed  0, 0
ans =

    ' IL_87907.2  5AOX C   18 G   11'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CCC (   1) MLPS  -4.11 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_87907.2  6IA2 G    2 C   18'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CCC (   1) MLPS  -4.11 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_87907.2  6IA2 G   11 C    9'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CCC (   1) MLPS  -4.11 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_87907.2  6IA2 G   11 C    9'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CCC (   1) MLPS  -4.11 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_87907.2  6IA2 G    2 C   18'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CCC (   1) MLPS  -4.11 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_87907.2  7KFN G   14 C   10'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CCC (   1) MLPS  -4.11 deficit   0.35 prct   0.00 CutScore  96.34;  Ed  0, 0
ans =

    ' IL_87907.2  9D5J G   14 C   19'

 matches the original group, cWW-cWW-cWW
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  4NGF G    7 C    9'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  7ECO G    3 C   10'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  7ECO G    3 C   10'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  4PDQ G   28 C   21'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  4P3U G   28 C   21'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE G 1629 C 1746'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  4ZC7 G    5 C   44'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  4ZC7 G   28 C   21'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  5J7L G 1405 C 1496'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  4LFB G 1405 C 1496'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  1ZZ5 G   10 C   26'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A G 1642 C 1759'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  4PDQ G    5 C   44'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUC (   1) MLPS  -4.14 deficit   0.38 prct   0.00 CutScore  96.01;  Ed  0, 0
ans =

    ' IL_87907.2  4P3U G    5 C   44'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -2.80, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GAC*GCC (   1) MLPS  -4.25 deficit   0.49 prct   0.00 CutScore  94.85;  Ed  0, 0
ans =

    ' IL_87907.2  6OL3 G   53 C   80'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -4.12, deficit  1.32, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GAC*GCC (   1) MLPS  -4.25 deficit   0.49 prct   0.00 CutScore  94.85;  Ed  0, 0
ans =

    ' IL_87907.2  5Y85 G   13 C    6'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -4.12, deficit  1.32, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GAC*GCC (   1) MLPS  -4.25 deficit   0.49 prct   0.00 CutScore  94.85;  Ed  0, 0
ans =

    ' IL_87907.2  7ECN G    8 C    5'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -4.12, deficit  1.32, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GAC*GCC (   1) MLPS  -4.25 deficit   0.49 prct   0.00 CutScore  94.85;  Ed  0, 0
ans =

    ' IL_87907.2  7VYX G   11 C   55'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -4.12, deficit  1.32, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GAC*GCC (   1) MLPS  -4.25 deficit   0.49 prct   0.00 CutScore  94.85;  Ed  0, 0
ans =

    ' IL_87907.2  7ECN G    8 C    5'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -4.12, deficit  1.32, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              CCG*CCG (   1) MLPS  -4.42 deficit   0.65 prct   0.00 CutScore  93.11;  Ed  0, 0
ans =

    ' IL_87907.2  7OG0 C    9 G   11'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CCG (   1) MLPS  -4.42 deficit   0.65 prct   0.00 CutScore  93.11;  Ed  0, 0
ans =

    ' IL_87907.2  4E59 C    2 G    4'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CCG (   1) MLPS  -4.42 deficit   0.65 prct   0.00 CutScore  93.11;  Ed  0, 0
ans =

    ' IL_87907.2  7OFZ C    9 G   11'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CCG (   1) MLPS  -4.42 deficit   0.65 prct   0.00 CutScore  93.11;  Ed  0, 0
ans =

    ' IL_87907.2  7OFW C    9 G   11'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CCG (   1) MLPS  -4.42 deficit   0.65 prct   0.00 CutScore  93.11;  Ed  0, 0
ans =

    ' IL_87907.2  4KNQ C  213 G  209'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CCG (   1) MLPS  -4.42 deficit   0.65 prct   0.00 CutScore  93.11;  Ed  0, 0
ans =

    ' IL_87907.2  4KNQ C  210 G  212'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CCG (   1) MLPS  -4.42 deficit   0.65 prct   0.00 CutScore  93.11;  Ed  0, 0
ans =

    ' IL_87907.2  1G2J C    3 G    5'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCG*CCG (   1) MLPS  -4.42 deficit   0.65 prct   0.00 CutScore  93.11;  Ed  0, 0
ans =

    ' IL_87907.2  7A0S C 1252 G 1220'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAU*ACG (   1) MLPS  -4.51 deficit   0.74 prct   0.00 CutScore  92.19;  Ed  0, 0
ans =

    ' IL_87907.2  7A0S C  864 G  938'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAC*GGG (   1) MLPS  -4.62 deficit   0.86 prct   0.00 CutScore  91.00;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A C 3233 G 3254'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -4.71 deficit   0.94 prct   0.00 CutScore  90.06;  Ed  0, 0
ans =

    ' IL_87907.2  4WF9 C  851 G  719'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -4.71 deficit   0.94 prct   0.00 CutScore  90.06;  Ed  0, 0
ans =

    ' IL_87907.2  9DFE C  806 G  674'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -4.71 deficit   0.94 prct   0.00 CutScore  90.06;  Ed  0, 0
ans =

    ' IL_87907.2  5J7L C  806 G  674'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -4.71 deficit   0.94 prct   0.00 CutScore  90.06;  Ed  0, 0
ans =

    ' IL_87907.2  4V9F C  899 G  765'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -4.71 deficit   0.94 prct   0.00 CutScore  90.06;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A C  938 G  805'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -4.71 deficit   0.94 prct   0.00 CutScore  90.06;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE C  124 G  142'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -4.71 deficit   0.94 prct   0.00 CutScore  90.06;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A C  125 G  143'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -4.71 deficit   0.94 prct   0.00 CutScore  90.06;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE C  934 G  801'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUG*CCG (   1) MLPS  -4.71 deficit   0.94 prct   0.00 CutScore  90.06;  Ed  0, 0
ans =

    ' IL_87907.2  3RW6 C   33 G   26'

 matches the original group, cWW-cWW-cWW
Better:   1 Equal:   0 Score 0.00              GAU*ACC (   1) MLPS  -4.74 deficit   0.98 prct   0.00 CutScore  89.68;  Ed  0, 0
ans =

    ' IL_87907.2  5Y7M G   37 C   13'

 scores better against   1 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.52, deficit  0.34, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GAU*ACC (   1) MLPS  -4.74 deficit   0.98 prct   0.00 CutScore  89.68;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A G 2918 C 2928'

 scores better against   1 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.52, deficit  0.34, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GAU*ACC (   1) MLPS  -4.74 deficit   0.98 prct   0.00 CutScore  89.68;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE G 2890 C 2900'

 scores better against   1 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.52, deficit  0.34, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAC*GCU (   1) MLPS  -4.75 deficit   0.98 prct   0.00 CutScore  89.65;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE A 2084 U 1938'

 scores better against   2 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -4.30, deficit  1.50, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.45, deficit  0.28, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAC*GCU (   1) MLPS  -4.75 deficit   0.98 prct   0.00 CutScore  89.65;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE A  958 U  624'

 scores better against   2 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -4.30, deficit  1.50, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.45, deficit  0.28, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAC*GCU (   1) MLPS  -4.75 deficit   0.98 prct   0.00 CutScore  89.65;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A A 2106 U 1942'

 scores better against   2 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -4.30, deficit  1.50, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.45, deficit  0.28, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAC*GCU (   1) MLPS  -4.75 deficit   0.98 prct   0.00 CutScore  89.65;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A A  973 U  626'

 scores better against   2 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -4.30, deficit  1.50, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.45, deficit  0.28, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              GCC*GCC (   1) MLPS  -4.80 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_87907.2  3MEI G    8 C   15'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCC*GCC (   1) MLPS  -4.80 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_87907.2  7ZLQ G    5 C    7'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCC*GCC (   1) MLPS  -4.80 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_87907.2  6M6R G    2 C    7'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCC*GCC (   1) MLPS  -4.80 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_87907.2  4J39 G    9 C   11'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCC*GCC (   1) MLPS  -4.80 deficit   1.03 prct   0.00 CutScore  89.13;  Ed  0, 0
ans =

    ' IL_87907.2  7KJT G    2 C   71'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAC*GGC (   1) MLPS  -4.86 deficit   1.09 prct   0.00 CutScore  88.50;  Ed  0, 0
ans =

    ' IL_87907.2  4M4O G   46 C   14'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAC*GGC (   1) MLPS  -4.86 deficit   1.09 prct   0.00 CutScore  88.50;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE G 1782 C 1659'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAC*GGC (   1) MLPS  -4.86 deficit   1.09 prct   0.00 CutScore  88.50;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A G 1786 C 1663'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAC*GGC (   1) MLPS  -4.86 deficit   1.09 prct   0.00 CutScore  88.50;  Ed  0, 0
ans =

    ' IL_87907.2  4M6D G   46 C   14'

 matches the original group, cWW-cWW-cWW
Better:   1 Equal:   0 Score 0.00              CAA*UCG (   1) MLPS  -4.92 deficit   1.16 prct   0.00 CutScore  87.80;  Ed  0, 0
ans =

    ' IL_87907.2  1Y27 C   43 G   27'

 scores better against   1 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  0, 0, MLPS -4.31, deficit  0.13, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              CCU*ACG (   1) MLPS  -5.05 deficit   1.29 prct   0.00 CutScore  86.46;  Ed  0, 0
ans =

    ' IL_87907.2  4YHW C   68 G   13'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CGG*CAG (   1) MLPS  -5.07 deficit   1.31 prct   0.00 CutScore  86.26;  Ed  0, 0
ans =

    ' IL_87907.2  4LFB C   67 G  102'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GCC (   1) MLPS  -5.09 deficit   1.32 prct   0.00 CutScore  86.07;  Ed  0, 0
ans =

    ' IL_87907.2  7ECP G    8 C    5'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUC*GCC (   1) MLPS  -5.09 deficit   1.32 prct   0.00 CutScore  86.07;  Ed  0, 0
ans =

    ' IL_87907.2  7A0S G  767 C  756'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACG*CCU (   1) MLPS  -5.15 deficit   1.39 prct   0.00 CutScore  85.41;  Ed  0, 0
ans =

    ' IL_87907.2  4YHW A   11 U   70'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACG*CCU (   1) MLPS  -5.15 deficit   1.39 prct   0.00 CutScore  85.41;  Ed  0, 0
ans =

    ' IL_87907.2  8AF0 A   37 U   33'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACG*CCU (   1) MLPS  -5.15 deficit   1.39 prct   0.00 CutScore  85.41;  Ed  0, 0
ans =

    ' IL_87907.2  8AF0 A   37 U   33'

 matches the original group, cWW-cWW-cWW
Better:   2 Equal:   0 Score 0.00              GAA*UCC (   1) MLPS  -5.16 deficit   1.40 prct   0.00 CutScore  85.30;  Ed  0, 0
ans =

    ' IL_87907.2  1KFO G    1 C   18'

 scores better against   2 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  0, 0, MLPS -4.31, deficit  0.14, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -4.91, deficit  2.11, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAU*ACU (   1) MLPS  -5.24 deficit   1.47 prct   0.00 CutScore  84.48;  Ed  0, 0
ans =

    ' IL_87907.2  5CCB A   37 U   33'

 scores better against   2 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.46, deficit  0.29, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -5.10, deficit  2.30, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAU*ACU (   1) MLPS  -5.24 deficit   1.47 prct   0.00 CutScore  84.48;  Ed  0, 0
ans =

    ' IL_87907.2  1Z79 A   10 U    7'

 scores better against   2 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.46, deficit  0.29, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -5.10, deficit  2.30, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAU*ACU (   1) MLPS  -5.24 deficit   1.47 prct   0.00 CutScore  84.48;  Ed  0, 0
ans =

    ' IL_87907.2  1Z7F A   26 U    7'

 scores better against   2 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.46, deficit  0.29, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -5.10, deficit  2.30, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAU*ACU (   1) MLPS  -5.24 deficit   1.47 prct   0.00 CutScore  84.48;  Ed  0, 0
ans =

    ' IL_87907.2  7ECK A    8 U    5'

 scores better against   2 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.46, deficit  0.29, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -5.10, deficit  2.30, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAU*ACU (   1) MLPS  -5.24 deficit   1.47 prct   0.00 CutScore  84.48;  Ed  0, 0
ans =

    ' IL_87907.2  7ECK A    8 U    5'

 scores better against   2 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.46, deficit  0.29, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -5.10, deficit  2.30, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAU*ACU (   1) MLPS  -5.24 deficit   1.47 prct   0.00 CutScore  84.48;  Ed  0, 0
ans =

    ' IL_87907.2  5D0B A   37 U   33'

 scores better against   2 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.46, deficit  0.29, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -5.10, deficit  2.30, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAU*ACU (   1) MLPS  -5.24 deficit   1.47 prct   0.00 CutScore  84.48;  Ed  0, 0
ans =

    ' IL_87907.2  1Z79 A   10 U    7'

 scores better against   2 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.46, deficit  0.29, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -5.10, deficit  2.30, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AAU*ACU (   1) MLPS  -5.24 deficit   1.47 prct   0.00 CutScore  84.48;  Ed  0, 0
ans =

    ' IL_87907.2  1Z7F A   10 U   23'

 scores better against   2 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 0, MLPS -4.46, deficit  0.29, prct   0.00; IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -5.10, deficit  2.30, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              CAG*CAG (   1) MLPS  -5.24 deficit   1.48 prct   0.00 CutScore  84.43;  Ed  0, 0
ans =

    ' IL_87907.2  4J50 C   10 G   12'

 scores better against   2 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.88, deficit  0.05, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  0, 0, MLPS -5.12, deficit  0.66, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              CAG*CAG (   1) MLPS  -5.24 deficit   1.48 prct   0.00 CutScore  84.43;  Ed  0, 0
ans =

    ' IL_87907.2  7VFT C   11 G   13'

 scores better against   2 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.88, deficit  0.05, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  0, 0, MLPS -5.12, deficit  0.66, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              GGG*CAC (   1) MLPS  -5.31 deficit   1.54 prct   0.00 CutScore  83.76;  Ed  0, 0
ans =

    ' IL_87907.2  3D0U G  112 C  136'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGG*CAC (   1) MLPS  -5.31 deficit   1.54 prct   0.00 CutScore  83.76;  Ed  0, 0
ans =

    ' IL_87907.2  2R8S G  110 C  211'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGG*CAC (   1) MLPS  -5.31 deficit   1.54 prct   0.00 CutScore  83.76;  Ed  0, 0
ans =

    ' IL_87907.2  3DIL G  115 C  139'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CUU*ACG (   1) MLPS  -5.34 deficit   1.58 prct   0.00 CutScore  83.41;  Ed  0, 0
ans =

    ' IL_87907.2  4V9F C  558 G  599'

 matches the original group, cWW-cWW-cWW
Better:   1 Equal:   0 Score 0.00              GAU*AGC (   1) MLPS  -5.35 deficit   1.58 prct   0.00 CutScore  83.33;  Ed  0, 0
ans =

    ' IL_87907.2  8D29 G    4 C   31'

 scores better against   1 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 0, MLPS -5.29, deficit  1.32, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              AAC*GGU (   1) MLPS  -5.35 deficit   1.59 prct   0.00 CutScore  83.29;  Ed  0, 0
ans =

    ' IL_87907.2  3HHN A  102 U   89'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              AAC*GGU (   1) MLPS  -5.35 deficit   1.59 prct   0.00 CutScore  83.29;  Ed  0, 0
ans =

    ' IL_87907.2  3IVK A  102 U   89'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GGC*GAC (   1) MLPS  -5.45 deficit   1.68 prct   0.00 CutScore  82.28;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A G 1672 C 1729'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CCC*GUG (   1) MLPS  -5.59 deficit   1.83 prct   0.00 CutScore  80.77;  Ed  0, 0
ans =

    ' IL_87907.2  4LFB C  186 G  191'

 matches the original group, cWW-cWW-cWW
Better:   2 Equal:   0 Score 0.00              UAG*CGA (   1) MLPS  -5.61 deficit   1.85 prct   0.00 CutScore  80.52;  Ed  0, 0
ans =

    ' IL_87907.2  5DO5 U  108 A  105'

 scores better against   2 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -5.08, deficit  1.11, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -5.18, deficit  2.20, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              UAG*CGA (   1) MLPS  -5.61 deficit   1.85 prct   0.00 CutScore  80.52;  Ed  0, 0
ans =

    ' IL_87907.2  4RBZ U  108 A  105'

 scores better against   2 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -5.08, deficit  1.11, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -5.18, deficit  2.20, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              UAG*CGA (   1) MLPS  -5.61 deficit   1.85 prct   0.00 CutScore  80.52;  Ed  0, 0
ans =

    ' IL_87907.2  4RBY U  108 A  105'

 scores better against   2 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -5.08, deficit  1.11, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -5.18, deficit  2.20, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GAC*GAC (   1) MLPS  -5.62 deficit   1.86 prct   0.00 CutScore  80.44;  Ed  0, 0
ans =

    ' IL_87907.2  5ED1 G   13 C   11'

 scores better against   1 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.75, deficit -0.08, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              CUA*UCG (   1) MLPS  -5.76 deficit   1.99 prct   0.00 CutScore  79.02;  Ed  0, 0
ans =

    ' IL_87907.2  7A0S C  819 G  687'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAU*GCG (   1) MLPS  -5.77 deficit   2.01 prct   0.00 CutScore  78.88;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE C 2861 G 2886'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAU*GCG (   1) MLPS  -5.77 deficit   2.01 prct   0.00 CutScore  78.88;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A C 2889 G 2914'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACU*ACU (   1) MLPS  -5.78 deficit   2.02 prct   0.00 CutScore  78.75;  Ed  0, 0
ans =

    ' IL_87907.2  1YZ9 A    4 U   17'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACU*ACU (   1) MLPS  -5.78 deficit   2.02 prct   0.00 CutScore  78.75;  Ed  0, 0
ans =

    ' IL_87907.2  5AY2 A    3 U   10'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACU*ACU (   1) MLPS  -5.78 deficit   2.02 prct   0.00 CutScore  78.75;  Ed  0, 0
ans =

    ' IL_87907.2  5AY2 A    3 U   10'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUG*CUU (   1) MLPS  -5.81 deficit   2.04 prct   0.00 CutScore  78.51;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE G 1083 U 1067'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GUG*CUU (   1) MLPS  -5.81 deficit   2.04 prct   0.00 CutScore  78.51;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A G 1087 U 1071'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCC*GUC (   1) MLPS  -5.83 deficit   2.06 prct   0.00 CutScore  78.27;  Ed  0, 0
ans =

    ' IL_87907.2  7ECP G    3 C   10'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCC*GUC (   1) MLPS  -5.83 deficit   2.06 prct   0.00 CutScore  78.27;  Ed  0, 0
ans =

    ' IL_87907.2  4LFB G 1464 C 1437'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GAG*CCU (   1) MLPS  -5.92 deficit   2.15 prct   0.00 CutScore  77.35;  Ed  0, 0
ans =

    ' IL_87907.2  1KFO G   11 U    8'

 matches the original group, cWW-cWW-cWW
Better:   1 Equal:   0 Score 0.00              GUC*GUU (   1) MLPS  -5.95 deficit   2.18 prct   0.00 CutScore  77.02;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE G 1198 U 1436'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.45, deficit  2.65, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              GUC*GUU (   1) MLPS  -5.95 deficit   2.18 prct   0.00 CutScore  77.02;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A G 1213 U 1450'

 scores better against   1 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.45, deficit  2.65, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              UUA*UUA (   1) MLPS  -5.95 deficit   2.19 prct   0.00 CutScore  77.00;  Ed  0, 0
ans =

    ' IL_87907.2  2ZKO U    9 A   11'

 scores better against   3 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  0, 0, MLPS -4.41, deficit  1.61, prct   0.00; IL_42771.1,  4 NTs, cWW-cWW                                 , Ed  0, 0, MLPS -4.81, deficit  0.31, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.39, deficit  0.25, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              GAU*GCC (   1) MLPS  -6.01 deficit   2.24 prct   0.00 CutScore  76.37;  Ed  0, 0
ans =

    ' IL_87907.2  4X4N G   28 C    4'

 matches the original group, cWW-cWW-cWW
Better:   1 Equal:   0 Score 0.00              AUU*ACU (   1) MLPS  -6.07 deficit   2.31 prct   0.00 CutScore  75.70;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE A 1116 U 1134'

 scores better against   1 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.02, deficit  0.05, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              AUU*ACU (   1) MLPS  -6.07 deficit   2.31 prct   0.00 CutScore  75.70;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A A 1120 U 1138'

 scores better against   1 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.02, deficit  0.05, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              GAU*AAC (   1) MLPS  -6.11 deficit   2.35 prct   0.00 CutScore  75.27;  Ed  0, 0
ans =

    ' IL_87907.2  8K85 G   26 C   25'

 scores better against   5 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.94, deficit  0.11, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -5.53, deficit  1.07, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  4, 1, MLPS -5.66, deficit -0.36, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -5.76, deficit -0.21, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  3, 1, MLPS -6.03, deficit  1.85, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              GAU*AAC (   1) MLPS  -6.11 deficit   2.35 prct   0.00 CutScore  75.27;  Ed  0, 0
ans =

    ' IL_87907.2  8K85 G   26 C   25'

 scores better against   5 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.94, deficit  0.11, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -5.53, deficit  1.07, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  4, 1, MLPS -5.66, deficit -0.36, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -5.76, deficit -0.21, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  3, 1, MLPS -6.03, deficit  1.85, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              CGA*UAG (   1) MLPS  -6.12 deficit   2.35 prct   0.00 CutScore  75.22;  Ed  0, 0
ans =

    ' IL_87907.2  8PFQ C    3 G   30'

 scores better against   2 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -5.08, deficit  1.11, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -5.18, deficit  2.20, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              CGA*UAG (   1) MLPS  -6.12 deficit   2.35 prct   0.00 CutScore  75.22;  Ed  0, 0
ans =

    ' IL_87907.2  8PFQ C   23 G   10'

 scores better against   2 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -5.08, deficit  1.11, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -5.18, deficit  2.20, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              ACA*UCU (   1) MLPS  -6.20 deficit   2.43 prct   0.00 CutScore  74.37;  Ed  0, 0
ans =

    ' IL_87907.2  7QQP A   14 U    7'

 matches the original group, cWW-cWW-cWW
Better:   3 Equal:   0 Score 0.00              UAU*AGA (   1) MLPS  -6.25 deficit   2.48 prct   0.00 CutScore  73.87;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A U 1039 A 1011'

 scores better against   3 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 0, MLPS -5.15, deficit  1.18, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 2, MLPS -5.65, deficit -0.33, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -5.94, deficit  2.96, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              UAU*AGA (   1) MLPS  -6.25 deficit   2.48 prct   0.00 CutScore  73.87;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE U 1035 A 1007'

 scores better against   3 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 0, MLPS -5.15, deficit  1.18, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 2, MLPS -5.65, deficit -0.33, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -5.94, deficit  2.96, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              CCU*AAG (   1) MLPS  -6.29 deficit   2.53 prct   0.00 CutScore  73.41;  Ed  0, 0
ans =

    ' IL_87907.2  4WF9 C 2111 G 2262'

 scores better against   1 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  0, 0, MLPS -4.26, deficit  0.08, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              CAU*GGG (   1) MLPS  -6.37 deficit   2.61 prct   0.00 CutScore  72.52;  Ed  0, 0
ans =

    ' IL_87907.2  5J7L C 1412 G 1488'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              CAU*GGG (   1) MLPS  -6.37 deficit   2.61 prct   0.00 CutScore  72.52;  Ed  0, 0
ans =

    ' IL_87907.2  4LFB C 1412 G 1488'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              ACG*CAU (   1) MLPS  -6.39 deficit   2.63 prct   0.00 CutScore  72.36;  Ed  0, 0
ans =

    ' IL_87907.2  4M4O A   52 U    8'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCG*CCU (   1) MLPS  -6.46 deficit   2.70 prct   0.00 CutScore  71.62;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A G 1464 U 1175'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCG*CCU (   1) MLPS  -6.46 deficit   2.70 prct   0.00 CutScore  71.62;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE G 1450 U 1160'

 matches the original group, cWW-cWW-cWW
Better:   2 Equal:   0 Score 0.00              AUA*UCU (   1) MLPS  -6.49 deficit   2.73 prct   0.00 CutScore  71.32;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE A  469 U   37'

 scores better against   2 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.05, deficit  0.07, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -6.12, deficit  0.98, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              AUA*UCU (   1) MLPS  -6.49 deficit   2.73 prct   0.00 CutScore  71.32;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A A  471 U   37'

 scores better against   2 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 0, MLPS -6.05, deficit  0.07, prct   0.00; IL_07785.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -6.12, deficit  0.98, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              UAC*GAA (   1) MLPS  -6.52 deficit   2.76 prct   0.00 CutScore  70.98;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A U 1650 A 1750'

 scores better against   5 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.97, deficit  0.14, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 1, MLPS -5.60, deficit -0.42, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -5.72, deficit -0.25, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -5.73, deficit  1.26, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  1, 1, MLPS -5.88, deficit  1.71, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              UAC*GAA (   1) MLPS  -6.52 deficit   2.76 prct   0.00 CutScore  70.98;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE U 1637 A 1737'

 scores better against   5 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -4.97, deficit  0.14, prct   0.00; IL_08770.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 1, MLPS -5.60, deficit -0.42, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -5.72, deficit -0.25, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -5.73, deficit  1.26, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  1, 1, MLPS -5.88, deficit  1.71, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UCA*UCA (   1) MLPS  -6.60 deficit   2.84 prct   0.00 CutScore  70.11;  Ed  0, 0
ans =

    ' IL_87907.2  1RPU U    9 A   11'

 scores better against   1 groups: IL_10796.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.34, deficit  2.75, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UCA*UCA (   1) MLPS  -6.60 deficit   2.84 prct   0.00 CutScore  70.11;  Ed  0, 0
ans =

    ' IL_87907.2  5C5W U    9 A   11'

 scores better against   1 groups: IL_10796.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.34, deficit  2.75, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UCG*CAA (   1) MLPS  -6.79 deficit   3.03 prct   0.00 CutScore  68.10;  Ed  0, 0
ans =

    ' IL_87907.2  7MLW U    4 A   59'

 scores better against   1 groups: IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  0, 0, MLPS -4.31, deficit  0.13, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              CGU*GAG (   1) MLPS  -6.97 deficit   3.20 prct   0.00 CutScore  66.30;  Ed  0, 0
ans =

    ' IL_87907.2  4AOB C   78 G   73'

 matches the original group, cWW-cWW-cWW
Better:   3 Equal:   0 Score 0.00              GGC*GGC (   1) MLPS  -6.98 deficit   3.22 prct   0.00 CutScore  66.11;  Ed  0, 0
ans =

    ' IL_87907.2  5UNE G   31 C   14'

 scores better against   3 groups: IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  0, 0, MLPS -3.62, deficit  0.64, prct   0.00; IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 0, MLPS -4.40, deficit  0.43, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  4, 2, MLPS -6.35, deficit  2.17, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              GGC*GGC (   1) MLPS  -6.98 deficit   3.22 prct   0.00 CutScore  66.11;  Ed  0, 0
ans =

    ' IL_87907.2  5UNE G   31 C   14'

 scores better against   3 groups: IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  0, 0, MLPS -3.62, deficit  0.64, prct   0.00; IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 0, MLPS -4.40, deficit  0.43, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  4, 2, MLPS -6.35, deficit  2.17, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              CAG*UGG (   1) MLPS  -7.41 deficit   3.65 prct   0.00 CutScore  61.63;  Ed  0, 0
ans =

    ' IL_87907.2  3CUL C   87 G   59'

 scores better against   4 groups: IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 0, MLPS -5.61, deficit  1.64, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -6.10, deficit  3.12, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  4, 1, MLPS -6.32, deficit  0.35, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 1, MLPS -7.13, deficit  2.22, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              GCU*GUC (   1) MLPS  -7.58 deficit   3.82 prct   0.00 CutScore  59.79;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE G  788 C  668'

 matches the original group, cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00              GCU*GUC (   1) MLPS  -7.58 deficit   3.82 prct   0.00 CutScore  59.79;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A G  792 C  670'

 matches the original group, cWW-cWW-cWW
Better:   4 Equal:   0 Score 0.00              CGA*UGG (   1) MLPS  -7.65 deficit   3.89 prct   0.00 CutScore  59.06;  Ed  0, 0
ans =

    ' IL_87907.2  8CRE C 1308 G 1277'

 scores better against   4 groups: IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -3.44, deficit  0.46, prct   0.00; IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  1, 0, MLPS -4.10, deficit  0.13, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  2, 2, MLPS -6.01, deficit  1.84, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  1, 1, MLPS -7.35, deficit  2.88, prct   0.00; 
Better:   6 Equal:   0 Score 0.00              UAU*AGG (   1) MLPS  -7.66 deficit   3.90 prct   0.00 CutScore  58.96;  Ed  0, 0
ans =

    ' IL_87907.2  1MFQ U  132 G  165'

 scores better against   6 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 2, MLPS -6.27, deficit  0.29, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -6.60, deficit  3.62, prct   0.00; IL_96371.1,  6 NTs, cWW-tHH-cWW                             , Ed  3, 1, MLPS -6.66, deficit  2.40, prct   0.00; IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.97, deficit  3.00, prct   0.00; IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  0, 0, MLPS -7.10, deficit  2.24, prct   0.00; 
Better:   7 Equal:   0 Score 0.00              UAG*CAG (   1) MLPS  -7.80 deficit   4.03 prct   0.00 CutScore  57.56;  Ed  0, 0
ans =

    ' IL_87907.2  5UNE U   16 G   29'

 scores better against   7 groups: IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -6.18, deficit  1.34, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -6.56, deficit  0.59, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  1, 1, MLPS -6.70, deficit  2.52, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  0, 0, MLPS -7.36, deficit  4.38, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  1, 0, MLPS -7.44, deficit  2.97, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              CGG*UAG (   1) MLPS  -8.00 deficit   4.24 prct   0.00 CutScore  55.41;  Ed  0, 0
ans =

    ' IL_87907.2  7QUA C 1003 G 1010'

 scores better against   5 groups: IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  1, 0, MLPS -5.84, deficit  2.86, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  4, 2, MLPS -6.44, deficit  0.47, prct   0.00; IL_96371.1,  6 NTs, cWW-tHH-cWW                             , Ed  1, 1, MLPS -6.57, deficit  2.30, prct   0.00; IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  1, 0, MLPS -6.87, deficit  2.01, prct   0.00; IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.90, deficit  2.93, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              UCC*GAG (   1) MLPS  -8.35 deficit   4.59 prct   0.00 CutScore  51.71;  Ed  0, 0
ans =

    ' IL_87907.2  9DFE U  963 G  954'

 scores better against   3 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -5.79, deficit  3.00, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  1, 0, MLPS -6.11, deficit  1.94, prct   0.00; IL_10796.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 1, MLPS -6.91, deficit  3.31, prct   0.00; 
Better:   3 Equal:   0 Score 0.00              UCC*GAG (   1) MLPS  -8.35 deficit   4.59 prct   0.00 CutScore  51.71;  Ed  0, 0
ans =

    ' IL_87907.2  7A0S U  974 G  965'

 scores better against   3 groups: IL_28037.2,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -5.79, deficit  3.00, prct   0.00; IL_67095.2,  6 NTs, cWW-tWW-cWW                             , Ed  1, 0, MLPS -6.11, deficit  1.94, prct   0.00; IL_10796.1,  6 NTs, cWW-L-R-cWW                             , Ed  3, 1, MLPS -6.91, deficit  3.31, prct   0.00; 
Better:   0 Equal:   0 Score 1.00              GCU*GAU (   1) MLPS  -9.60 deficit   5.83 prct   0.00 CutScore  38.61;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A G 2824 U 2865'

 matches the original group, cWW-cWW-cWW
Better:  13 Equal:   0 Score 0.00             CAU*AGUG (   1) MLPS  -9.75 deficit   5.99 prct   0.00 CutScore  36.97;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A C   94 G   87'

 scores better against  13 groups: IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -6.08, deficit  1.17, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -7.14, deficit  0.10, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -7.33, deficit  0.33, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  1, 1, MLPS -7.49, deficit  3.02, prct   0.00; IL_96371.1,  6 NTs, cWW-tHH-cWW                             , Ed  4, 1, MLPS -7.54, deficit  3.28, prct   0.00; 
Better:  13 Equal:   0 Score 0.00             CAU*AGUG (   1) MLPS  -9.75 deficit   5.99 prct   0.00 CutScore  36.97;  Ed  0, 0
ans =

    ' IL_87907.2  8OI5 C   94 G   87'

 scores better against  13 groups: IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -6.08, deficit  1.17, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -7.14, deficit  0.10, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -7.33, deficit  0.33, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  1, 1, MLPS -7.49, deficit  3.02, prct   0.00; IL_96371.1,  6 NTs, cWW-tHH-cWW                             , Ed  4, 1, MLPS -7.54, deficit  3.28, prct   0.00; 
Better:  16 Equal:   0 Score 0.00             CAC*GGAG (   1) MLPS  -9.77 deficit   6.01 prct   0.00 CutScore  36.76;  Ed  0, 0
ans =

    ' IL_87907.2  5MSF C   13 G    6'

 scores better against  16 groups: IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 0, MLPS -4.95, deficit  1.53, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -5.24, deficit  0.32, prct   0.00; IL_42997.3,  6 NTs, cWW-L-R-cWW                             , Ed  3, 1, MLPS -6.31, deficit  1.84, prct   0.00; IL_61341.1,  6 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -6.97, deficit  0.03, prct   0.00; IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  1, 1, MLPS -7.07, deficit  1.45, prct   0.00; 
Better:  11 Equal:   0 Score 0.00             CAC*GGGG (   1) MLPS  -9.77 deficit   6.01 prct   0.00 CutScore  36.76;  Ed  0, 0
ans =

    ' IL_87907.2  1U1Y C   13 G    6'

 scores better against  11 groups: IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  2, 1, MLPS -5.87, deficit  0.96, prct   0.00; IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  2, 0, MLPS -6.11, deficit  1.25, prct   0.00; IL_96371.1,  6 NTs, cWW-tHH-cWW                             , Ed  3, 0, MLPS -6.42, deficit  2.16, prct   0.00; IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  1, 0, MLPS -6.85, deficit  1.23, prct   0.00; IL_61341.1,  6 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -7.48, deficit  0.54, prct   0.00; 
Better:  17 Equal:   0 Score 0.00             CAC*GAGG (   1) MLPS -10.44 deficit   6.68 prct   0.00 CutScore  29.67;  Ed  0, 0
ans =

    ' IL_87907.2  1XJR C   16 G   35'

 scores better against  17 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 1, MLPS -4.82, deficit -0.75, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -6.22, deficit  1.30, prct   0.00; IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  1, 1, MLPS -6.30, deficit  0.68, prct   0.00; IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  1, 1, MLPS -6.72, deficit  3.30, prct   0.00; IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  3, 1, MLPS -6.79, deficit  1.93, prct   0.00; 
Better:  19 Equal:   0 Score 0.00             CUAC*GAG (   1) MLPS -11.21 deficit   7.45 prct   0.00 CutScore  21.61;  Ed  0, 0
ans =

    ' IL_87907.2  8P9A C 1339 G 1385'

 scores better against  19 groups: IL_83389.2,  4 NTs, cWW-cWW                                 , Ed  2, 0, MLPS -5.77, deficit  0.05, prct   0.00; IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 1, MLPS -6.80, deficit  0.83, prct   0.00; IL_31737.3,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -7.06, deficit  2.22, prct   0.00; IL_61341.1,  6 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -7.11, deficit  0.17, prct   0.00; IL_31531.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 1, MLPS -7.22, deficit  3.79, prct   0.00; 
Group  56 is from IL_13404.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_13404.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            UUCG*UUCG (   1) MLPS  -4.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13404.2  422D U    7 G   22'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUCG*UUCG (   1) MLPS  -4.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13404.2  4ERD U  127 G  142'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUCG*UUCG (   1) MLPS  -4.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13404.2  1IHA U    3 G    6'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUCG*UUCG (   1) MLPS  -4.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13404.2  1ICG U    3 G    6'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUCG*UUCG (   1) MLPS  -4.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13404.2  255D U    5 G    8'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUCG*UUCG (   1) MLPS  -4.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13404.2  6L0Y U   10 G   13'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUCG*UUCG (   1) MLPS  -4.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13404.2  1QBP U   22 G   10'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUCG*UUCG (   1) MLPS  -4.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_13404.2  413D U    6 G    9'

 matches the original group, cWW-cWW-cWW-cWW
Better:   5 Equal:   0 Score 0.00            GGCU*AUUC (   1) MLPS  -9.57 deficit   5.35 prct   0.00 CutScore  57.99;  Ed  0, 0
ans =

    ' IL_13404.2  4WF9 G 2217 C 2126'

 scores better against   5 groups: IL_51479.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  5, 2, MLPS -7.00, deficit  0.00, prct   0.00; IL_92446.2,  7 NTs, cWW-cWW-R-L-L                           , Ed  6, 2, MLPS -8.17, deficit  3.94, prct   0.00; IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  3, 2, MLPS -8.26, deficit  3.18, prct   0.00; IL_85033.2,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  3, 2, MLPS -8.67, deficit  2.33, prct   0.00; IL_77658.1,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  3, 1, MLPS -9.16, deficit  4.82, prct   0.00; 
Better:   4 Equal:   0 Score 0.00           AGAG*CUACU (   1) MLPS -13.84 deficit   9.62 prct   0.00 CutScore  24.45;  Ed  0, 0
ans =

    ' IL_13404.2  8CRE A 1368 U 1328'

 scores better against   4 groups: IL_64231.5,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  3, 2, MLPS -9.22, deficit  2.54, prct   0.00; IL_65718.4,  9 NTs, cWW-cSH-cWS-cWW-cWW                     , Ed  7, 3, MLPS -9.26, deficit  3.55, prct   0.00; IL_62012.1,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  7, 3, MLPS -10.16, deficit  3.78, prct   0.00; IL_53448.1,  8 NTs, cWW-tWH-cSH-cWW                         , Ed  4, 2, MLPS -13.03, deficit  9.01, prct   0.00; 
Group 318 is from IL_77658.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_77658.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77658.1  8P9A C 3235 G 3252'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77658.1  3R2D C    6 G    9'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77658.1  280D C   17 G    8'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77658.1  4EYA C    6 G    9'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77658.1  8P9A C  726 G  712'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUG*CUUG (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77658.1  8P9A C 1495 G 1512'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUG*CUUA (   1) MLPS  -4.72 deficit   0.38 prct   0.00 CutScore  96.14;  Ed  0, 0
ans =

    ' IL_77658.1  8CRE U 3214 A 3203'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUG*CUUA (   1) MLPS  -4.72 deficit   0.38 prct   0.00 CutScore  96.14;  Ed  0, 0
ans =

    ' IL_77658.1  8P9A U 3300 A 3314'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            AUUG*CUUU (   1) MLPS  -4.78 deficit   0.44 prct   0.00 CutScore  95.56;  Ed  0, 0
ans =

    ' IL_77658.1  8CRE A 1339 U 1357'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            AUUG*CUUU (   1) MLPS  -4.78 deficit   0.44 prct   0.00 CutScore  95.56;  Ed  0, 0
ans =

    ' IL_77658.1  6MWN A  643 U  664'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUA*UUUG (   1) MLPS  -4.93 deficit   0.59 prct   0.00 CutScore  94.06;  Ed  0, 0
ans =

    ' IL_77658.1  8CRE C 3276 G 3268'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUC*GUUA (   1) MLPS  -5.00 deficit   0.65 prct   0.00 CutScore  93.39;  Ed  0, 0
ans =

    ' IL_77658.1  8CRE U  300 A  112'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUUC*GUUA (   1) MLPS  -5.00 deficit   0.65 prct   0.00 CutScore  93.39;  Ed  0, 0
ans =

    ' IL_77658.1  8P9A U  302 A  112'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUAG*CCUG (   1) MLPS  -5.11 deficit   0.76 prct   0.00 CutScore  92.29;  Ed  0, 0
ans =

    ' IL_77658.1  5C5W C   15 G    5'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUUC*GUUC (   1) MLPS  -5.13 deficit   0.79 prct   0.00 CutScore  92.02;  Ed  0, 0
ans =

    ' IL_77658.1  4UYK G   81 C  120'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUCC*GUUG (   1) MLPS  -5.81 deficit   1.47 prct   0.00 CutScore  85.15;  Ed  0, 0
ans =

    ' IL_77658.1  6JDV C   32 G   69'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUCC*GUUG (   1) MLPS  -5.81 deficit   1.47 prct   0.00 CutScore  85.15;  Ed  0, 0
ans =

    ' IL_77658.1  8HNT C   32 G   57'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GUCG*CUUC (   1) MLPS  -6.06 deficit   1.72 prct   0.00 CutScore  82.66;  Ed  0, 0
ans =

    ' IL_77658.1  8UIW G  112 C  103'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUC*GUCG (   1) MLPS  -6.06 deficit   1.72 prct   0.00 CutScore  82.63;  Ed  0, 0
ans =

    ' IL_77658.1  3TZR C   62 G  105'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUUC*GUCG (   1) MLPS  -6.06 deficit   1.72 prct   0.00 CutScore  82.63;  Ed  0, 0
ans =

    ' IL_77658.1  2PN3 C   62 G  105'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            ACUG*CUUU (   1) MLPS  -6.06 deficit   1.72 prct   0.00 CutScore  82.61;  Ed  0, 0
ans =

    ' IL_77658.1  8ID2 A    5 U   20'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CUCA*UUUG (   1) MLPS  -6.13 deficit   1.79 prct   0.00 CutScore  81.95;  Ed  0, 0
ans =

    ' IL_77658.1  8P9A C 1675 G 1726'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            AUUC*GUCU (   1) MLPS  -6.50 deficit   2.16 prct   0.00 CutScore  78.19;  Ed  0, 0
ans =

    ' IL_77658.1  7A0S A 1175 U 1199'

 matches the original group, cWW-cWW-cWW-cWW
Better:   2 Equal:   0 Score 0.00            UUCU*AUUA (   1) MLPS  -6.52 deficit   2.18 prct   0.00 CutScore  77.99;  Ed  0, 0
ans =

    ' IL_77658.1  8P9A U 1041 A 1009'

 scores better against   2 groups: IL_78800.1,  6 NTs, cWW-cSH-L-cWW                           , Ed  1, 1, MLPS -4.89, deficit  0.00, prct   0.00; IL_96759.1,  8 NTs, cWW-tSH-tWW-cWW                         , Ed  5, 3, MLPS -6.29, deficit  1.40, prct   0.00; 
Better:   2 Equal:   0 Score 0.00            UUCU*AUUA (   1) MLPS  -6.52 deficit   2.18 prct   0.00 CutScore  77.99;  Ed  0, 0
ans =

    ' IL_77658.1  8CRE U 1037 A 1005'

 scores better against   2 groups: IL_78800.1,  6 NTs, cWW-cSH-L-cWW                           , Ed  1, 1, MLPS -4.89, deficit  0.00, prct   0.00; IL_96759.1,  8 NTs, cWW-tSH-tWW-cWW                         , Ed  5, 3, MLPS -6.29, deficit  1.40, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            CCUG*CCUG (   1) MLPS  -7.14 deficit   2.80 prct   0.00 CutScore  71.76;  Ed  0, 0
ans =

    ' IL_77658.1  4XW1 C    2 G    5'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CCUG*CCUG (   1) MLPS  -7.14 deficit   2.80 prct   0.00 CutScore  71.76;  Ed  0, 0
ans =

    ' IL_77658.1  4XW0 C    2 G    5'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CCUG*CCUG (   1) MLPS  -7.14 deficit   2.80 prct   0.00 CutScore  71.76;  Ed  0, 0
ans =

    ' IL_77658.1  4K27 C   41 G   15'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CCUG*CCUG (   1) MLPS  -7.14 deficit   2.80 prct   0.00 CutScore  71.76;  Ed  0, 0
ans =

    ' IL_77658.1  4K27 C   45 G   11'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GCUG*CUCC (   1) MLPS  -7.32 deficit   2.98 prct   0.00 CutScore  69.90;  Ed  0, 0
ans =

    ' IL_77658.1  8CRE G 1710 C 1665'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            UUCC*GUUG (   1) MLPS  -7.51 deficit   3.17 prct   0.00 CutScore  68.04;  Ed  0, 0
ans =

    ' IL_77658.1  8X5V U   28 G   43'

 matches the original group, cWW-cWW-cWW-cWW
Better:   2 Equal:   0 Score 0.00            CCAG*CCAG (   1) MLPS  -7.72 deficit   3.38 prct   0.00 CutScore  65.88;  Ed  0, 0
ans =

    ' IL_77658.1  402D C  103 G  114'

 scores better against   2 groups: IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  2, 1, MLPS -7.41, deficit  2.34, prct   0.00; IL_80398.1,  8 NTs, cWW-L-cSW-L-R-cWW                       , Ed  6, 2, MLPS -7.70, deficit  2.43, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            UUUG*UUUG (   1) MLPS  -8.17 deficit   3.83 prct   0.00 CutScore  61.31;  Ed  0, 0
ans =

    ' IL_77658.1  205D U    5 G   20'

 matches the original group, cWW-cWW-cWW-cWW
Better:   3 Equal:   0 Score 0.00           AGUUC*GUCU (   1) MLPS -11.91 deficit   7.57 prct   0.00 CutScore  23.62;  Ed  0, 0
ans =

    ' IL_77658.1  7LYF A   90 U   42'

 scores better against   3 groups: IL_26728.3,  9 NTs, cWW-cSH-R-cSH-cWW-cWW                   , Ed  6, 2, MLPS -9.40, deficit  4.25, prct   0.00; IL_51479.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  5, 2, MLPS -10.26, deficit  3.26, prct   0.00; IL_22373.1,  8 NTs, cWW-L-R-cSH-cSH-cWW                     , Ed  2, 1, MLPS -10.69, deficit  7.11, prct   0.00; 
Group 353 is from IL_85033.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85033.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00            GGAC*GGAC (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85033.2  5LQT G    4 C    7'

 scores better against   1 groups: IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  0, 0, MLPS -5.66, deficit  0.59, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            GGAC*GGAC (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85033.2  5LQO G    4 C    7'

 scores better against   1 groups: IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  0, 0, MLPS -5.66, deficit  0.59, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            GGAC*GGAC (   1) MLPS  -6.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85033.2  3CJZ G    5 C   21'

 scores better against   1 groups: IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  0, 0, MLPS -5.66, deficit  0.59, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            GGAC*GGUC (   1) MLPS  -6.95 deficit   0.60 prct   0.00 CutScore  93.64;  Ed  0, 0
ans =

    ' IL_85033.2  8P9A G  953 C  874'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GGAC*GGUC (   1) MLPS  -6.95 deficit   0.60 prct   0.00 CutScore  93.64;  Ed  0, 0
ans =

    ' IL_85033.2  8CRE G  938 C  859'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            CAGG*CAGG (   1) MLPS  -7.10 deficit   0.75 prct   0.00 CutScore  92.06;  Ed  0, 0
ans =

    ' IL_85033.2  333D C    3 G    6'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GACC*GACC (   1) MLPS  -7.20 deficit   0.86 prct   0.00 CutScore  90.99;  Ed  0, 0
ans =

    ' IL_85033.2  1D4R G    4 C   25'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GACC*GACC (   1) MLPS  -7.20 deficit   0.86 prct   0.00 CutScore  90.99;  Ed  0, 0
ans =

    ' IL_85033.2  1JID G  138 C  159'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GACC*GACC (   1) MLPS  -7.20 deficit   0.86 prct   0.00 CutScore  90.99;  Ed  0, 0
ans =

    ' IL_85033.2  1D4R G   22 C    7'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GACC*GACC (   1) MLPS  -7.20 deficit   0.86 prct   0.00 CutScore  90.99;  Ed  0, 0
ans =

    ' IL_85033.2  1MFQ G  156 C  141'

 matches the original group, cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00            GACC*GACC (   1) MLPS  -7.20 deficit   0.86 prct   0.00 CutScore  90.99;  Ed  0, 0
ans =

    ' IL_85033.2  1L9A G  138 C  159'

 matches the original group, cWW-cWW-cWW-cWW
Better:   4 Equal:   0 Score 0.00            CUUC*GGUG (   1) MLPS  -8.30 deficit   1.96 prct   0.00 CutScore  79.37;  Ed  0, 0
ans =

    ' IL_85033.2  7VYX C   13 G   53'

 scores better against   4 groups: IL_92446.2,  7 NTs, cWW-cWW-R-L-L                           , Ed  5, 1, MLPS -7.06, deficit  2.84, prct   0.00; IL_77658.1,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  2, 1, MLPS -7.36, deficit  3.02, prct   0.00; IL_02203.1,  8 NTs, cWW-cSW-cWW-cWW                         , Ed  4, 2, MLPS -8.10, deficit  3.68, prct   0.00; IL_51479.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 1, MLPS -8.18, deficit  1.19, prct   0.00; 
Better:   2 Equal:   0 Score 0.00            GACU*ACCC (   1) MLPS  -8.33 deficit   1.99 prct   0.00 CutScore  79.10;  Ed  0, 0
ans =

    ' IL_85033.2  3WBM G   14 C   13'

 scores better against   2 groups: IL_84251.1,  8 NTs, cWW-L-tHS-cWW                           , Ed  5, 1, MLPS -7.94, deficit  1.03, prct   0.00; IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  4, 2, MLPS -8.20, deficit  3.13, prct   0.00; 
Better:   2 Equal:   0 Score 0.00            GACU*ACCC (   1) MLPS  -8.33 deficit   1.99 prct   0.00 CutScore  79.10;  Ed  0, 0
ans =

    ' IL_85033.2  3WBM G   14 C   13'

 scores better against   2 groups: IL_84251.1,  8 NTs, cWW-L-tHS-cWW                           , Ed  5, 1, MLPS -7.94, deficit  1.03, prct   0.00; IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  4, 2, MLPS -8.20, deficit  3.13, prct   0.00; 
Better:   5 Equal:   0 Score 0.00            GUUC*GUUC (   1) MLPS  -8.35 deficit   2.01 prct   0.00 CutScore  78.86;  Ed  0, 0
ans =

    ' IL_85033.2  8FER G    7 C   10'

 scores better against   5 groups: IL_77658.1,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  0, 0, MLPS -5.13, deficit  0.79, prct   0.00; IL_92446.2,  7 NTs, cWW-cWW-R-L-L                           , Ed  3, 1, MLPS -6.82, deficit  2.60, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  3, 2, MLPS -7.02, deficit  2.75, prct   0.00; IL_02203.1,  8 NTs, cWW-cSW-cWW-cWW                         , Ed  5, 1, MLPS -7.93, deficit  3.51, prct   0.00; IL_78800.1,  6 NTs, cWW-cSH-L-cWW                           , Ed  5, 2, MLPS -8.29, deficit  3.40, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            AGAC*GUAU (   1) MLPS  -8.43 deficit   2.09 prct   0.00 CutScore  78.05;  Ed  0, 0
ans =

    ' IL_85033.2  8P9A A  924 U  888'

 scores better against   4 groups: IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  1, 1, MLPS -6.64, deficit  1.57, prct   0.00; IL_80398.1,  8 NTs, cWW-L-cSW-L-R-cWW                       , Ed  4, 2, MLPS -7.66, deficit  2.39, prct   0.00; IL_84251.1,  8 NTs, cWW-L-tHS-cWW                           , Ed  6, 2, MLPS -8.06, deficit  1.16, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  6, 2, MLPS -8.09, deficit  1.09, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            AGAC*GUAU (   1) MLPS  -8.43 deficit   2.09 prct   0.00 CutScore  78.05;  Ed  0, 0
ans =

    ' IL_85033.2  8CRE A  909 U  873'

 scores better against   4 groups: IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  1, 1, MLPS -6.64, deficit  1.57, prct   0.00; IL_80398.1,  8 NTs, cWW-L-cSW-L-R-cWW                       , Ed  4, 2, MLPS -7.66, deficit  2.39, prct   0.00; IL_84251.1,  8 NTs, cWW-L-tHS-cWW                           , Ed  6, 2, MLPS -8.06, deficit  1.16, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  6, 2, MLPS -8.09, deficit  1.09, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            UACA*UUGA (   1) MLPS  -8.71 deficit   2.37 prct   0.00 CutScore  75.10;  Ed  0, 0
ans =

    ' IL_85033.2  8CRE U 2707 A 2693'

 scores better against   1 groups: IL_92446.2,  7 NTs, cWW-cWW-R-L-L                           , Ed  2, 0, MLPS -6.83, deficit  2.61, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            UACA*UUGA (   1) MLPS  -8.71 deficit   2.37 prct   0.00 CutScore  75.10;  Ed  0, 0
ans =

    ' IL_85033.2  8P9A U 2735 A 2721'

 scores better against   1 groups: IL_92446.2,  7 NTs, cWW-cWW-R-L-L                           , Ed  2, 0, MLPS -6.83, deficit  2.61, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            GCAC*GGAU (   1) MLPS  -9.00 deficit   2.66 prct   0.00 CutScore  72.05;  Ed  0, 0
ans =

    ' IL_85033.2  8CRE G 1059 U 1029'

 scores better against   1 groups: IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  2, 0, MLPS -8.92, deficit  3.85, prct   0.00; 
Better:   1 Equal:   0 Score 0.00            GCAC*GGAU (   1) MLPS  -9.00 deficit   2.66 prct   0.00 CutScore  72.05;  Ed  0, 0
ans =

    ' IL_85033.2  8P9A G 1074 U 1044'

 scores better against   1 groups: IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  2, 0, MLPS -8.92, deficit  3.85, prct   0.00; 
Better:   5 Equal:   0 Score 0.00            GCAC*GCAC (   1) MLPS  -9.18 deficit   2.83 prct   0.00 CutScore  70.21;  Ed  0, 0
ans =

    ' IL_85033.2  5UNE G   21 C   24'

 scores better against   5 groups: IL_80398.1,  8 NTs, cWW-L-cSW-L-R-cWW                       , Ed  4, 2, MLPS -7.69, deficit  2.42, prct   0.00; IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  2, 1, MLPS -8.00, deficit  2.93, prct   0.00; IL_77658.1,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  4, 0, MLPS -8.51, deficit  4.17, prct   0.00; IL_41344.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 2, MLPS -8.86, deficit  1.86, prct   0.00; IL_04785.1,  8 NTs, cWW-L-R-L-R-cWW                         , Ed  5, 2, MLPS -9.16, deficit  2.43, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            CCUG*CCUG (   1) MLPS  -9.34 deficit   3.00 prct   0.00 CutScore  68.47;  Ed  0, 0
ans =

    ' IL_85033.2  4K27 C    4 G   52'

 scores better against   4 groups: IL_77658.1,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  0, 0, MLPS -7.14, deficit  2.80, prct   0.00; IL_13404.2,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  6, 3, MLPS -7.94, deficit  3.72, prct   0.00; IL_99358.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 2, MLPS -8.85, deficit  1.81, prct   0.00; IL_92446.2,  7 NTs, cWW-cWW-R-L-L                           , Ed  4, 2, MLPS -9.26, deficit  5.04, prct   0.00; 
Better:   3 Equal:   0 Score 0.00            ACCG*CCUU (   1) MLPS  -9.54 deficit   3.19 prct   0.00 CutScore  66.41;  Ed  0, 0
ans =

    ' IL_85033.2  6JDV A   63 U   38'

 scores better against   3 groups: IL_43644.1,  8 NTs, cWW-cWW-L-R-cWW                         , Ed  3, 1, MLPS -6.97, deficit  1.36, prct   0.00; IL_77658.1,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  3, 1, MLPS -8.92, deficit  4.58, prct   0.00; IL_51479.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  3, 2, MLPS -9.49, deficit  2.49, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            AUUU*GUUU (   1) MLPS  -9.84 deficit   3.49 prct   0.00 CutScore  63.22;  Ed  0, 0
ans =

    ' IL_85033.2  8CRE A  445 U  484'

 scores better against   4 groups: IL_77658.1,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  2, 0, MLPS -7.49, deficit  3.15, prct   0.00; IL_78800.1,  6 NTs, cWW-cSH-L-cWW                           , Ed  5, 2, MLPS -7.74, deficit  2.85, prct   0.00; IL_92446.2,  7 NTs, cWW-cWW-R-L-L                           , Ed  4, 1, MLPS -9.10, deficit  4.88, prct   0.00; IL_02203.1,  8 NTs, cWW-cSW-cWW-cWW                         , Ed  4, 1, MLPS -9.26, deficit  4.84, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CGGGG*CAAG (   1) MLPS -10.19 deficit   3.85 prct   0.00 CutScore  59.50;  Ed  0, 0
ans =

    ' IL_85033.2  8CRE C  859 G  938'

 scores better against   1 groups: IL_48444.6,  8 NTs, cWW-L-R-cWW-cWW                         , Ed  4, 2, MLPS -9.82, deficit  2.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CGGGG*CAAG (   1) MLPS -10.19 deficit   3.85 prct   0.00 CutScore  59.50;  Ed  0, 0
ans =

    ' IL_85033.2  8P9A C  874 G  953'

 scores better against   1 groups: IL_48444.6,  8 NTs, cWW-L-R-cWW-cWW                         , Ed  4, 2, MLPS -9.82, deficit  2.00, prct   0.00; 
Better:   5 Equal:   0 Score 0.00            CCCG*CCCG (   1) MLPS -10.38 deficit   4.04 prct   0.00 CutScore  57.49;  Ed  0, 0
ans =

    ' IL_85033.2  5EW4 C    8 G   17'

 scores better against   5 groups: IL_43644.1,  8 NTs, cWW-cWW-L-R-cWW                         , Ed  0, 0, MLPS -6.41, deficit  0.80, prct   0.00; IL_84251.1,  8 NTs, cWW-L-tHS-cWW                           , Ed  2, 0, MLPS -7.55, deficit  0.65, prct   0.00; IL_09705.15,  8 NTs, cWW-tSH-tHS-cWW                         , Ed  4, 2, MLPS -7.56, deficit  2.48, prct   0.00; IL_04785.1,  8 NTs, cWW-L-R-L-R-cWW                         , Ed  0, 0, MLPS -8.18, deficit  1.45, prct   0.00; IL_51479.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -10.36, deficit  3.37, prct   0.00; 
Better:   4 Equal:   0 Score 0.00            CGGG*CGGG (   1) MLPS -10.67 deficit   4.32 prct   0.00 CutScore  54.50;  Ed  0, 0
ans =

    ' IL_85033.2  7R9G C    5 G    8'

 scores better against   4 groups: IL_04785.1,  8 NTs, cWW-L-R-L-R-cWW                         , Ed  4, 2, MLPS -6.14, deficit -0.59, prct   0.00; IL_25872.4,  8 NTs, cWW-cWW-cWH-cWW                         , Ed  0, 0, MLPS -7.42, deficit  1.41, prct   0.00; IL_51479.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  4, 2, MLPS -9.27, deficit  2.28, prct   0.00; IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  5, 1, MLPS -9.89, deficit  5.17, prct   0.00; 
Better:   2 Equal:   0 Score 0.00           UGGA*UAGAG (   1) MLPS -10.81 deficit   4.47 prct   0.00 CutScore  52.99;  Ed  0, 0
ans =

    ' IL_85033.2  5J7L U  740 G  666'

 scores better against   2 groups: IL_31558.1,  9 NTs, cWW-L-tHS-L-R-cWW                       , Ed  4, 2, MLPS -8.01, deficit  2.28, prct   0.00; IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  5, 1, MLPS -9.96, deficit  5.25, prct   0.00; 
Better:   2 Equal:   0 Score 0.00           UGGU*GAGAG (   1) MLPS -11.35 deficit   5.01 prct   0.00 CutScore  47.27;  Ed  0, 0
ans =

    ' IL_85033.2  4LFB U  740 G  666'

 scores better against   2 groups: IL_31558.1,  9 NTs, cWW-L-tHS-L-R-cWW                       , Ed  3, 2, MLPS -10.16, deficit  4.43, prct   0.00; IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  4, 1, MLPS -11.26, deficit  6.55, prct   0.00; 
Better:   2 Equal:   0 Score 0.00           UGGU*GAGAG (   1) MLPS -11.35 deficit   5.01 prct   0.00 CutScore  47.27;  Ed  0, 0
ans =

    ' IL_85033.2  1G1X U  740 G  666'

 scores better against   2 groups: IL_31558.1,  9 NTs, cWW-L-tHS-L-R-cWW                       , Ed  3, 2, MLPS -10.16, deficit  4.43, prct   0.00; IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  4, 1, MLPS -11.26, deficit  6.55, prct   0.00; 
Better:   2 Equal:   0 Score 0.00           UGGU*GAGAG (   1) MLPS -11.35 deficit   5.01 prct   0.00 CutScore  47.27;  Ed  0, 0
ans =

    ' IL_85033.2  1G1X U  740 G  666'

 scores better against   2 groups: IL_31558.1,  9 NTs, cWW-L-tHS-L-R-cWW                       , Ed  3, 2, MLPS -10.16, deficit  4.43, prct   0.00; IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  4, 1, MLPS -11.26, deficit  6.55, prct   0.00; 
Better:   2 Equal:   0 Score 0.00           UGGU*GAGAG (   1) MLPS -11.35 deficit   5.01 prct   0.00 CutScore  47.27;  Ed  0, 0
ans =

    ' IL_85033.2  1KUQ U   39 G   30'

 scores better against   2 groups: IL_31558.1,  9 NTs, cWW-L-tHS-L-R-cWW                       , Ed  3, 2, MLPS -10.16, deficit  4.43, prct   0.00; IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  4, 1, MLPS -11.26, deficit  6.55, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            GAAG*CGGC (   1) MLPS  -6.80 deficit   0.46 prct   0.00 CutScore  95.19;  Ed  0, 0
ans =

    ' IL_85033.2  5J7L G 1038 C 1117'

 matches the original group, cWW-cWW-cWW-cWW
Group 267 is from IL_65851.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_65851.3
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cWW-cWW-cWW-R-tHW-tSH-tHS-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GCCAGGC*GAGCAAC (   1) MLPS  -5.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65851.3  3KTW G  201 C  222'

 matches the original group, cWW-cWW-cWW-cWW-R-tHW-tSH-tHS-L
Better:   0 Equal:   0 Score 1.00      GCCAGGC*GAGCAAC (   1) MLPS  -5.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65851.3  3NDB G  200 C  221'

 matches the original group, cWW-cWW-cWW-cWW-R-tHW-tSH-tHS-L
Group 199 is from IL_49751.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_49751.4
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-cWW-cWW-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CUCUG*CUUUG (   1) MLPS  -7.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_49751.4  8VM8 C   54 G   78'

 matches the original group, cWW-cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          CUCUG*CUUUG (   1) MLPS  -7.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_49751.4  8DP3 C   54 G   75'

 matches the original group, cWW-cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          CUUUG*CUCUG (   1) MLPS  -7.32 deficit   0.06 prct   0.00 CutScore  99.45;  Ed  0, 0
ans =

    ' IL_49751.4  8VM9 C   68 G   52'

 matches the original group, cWW-cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          CUUUG*CUCUG (   1) MLPS  -7.32 deficit   0.06 prct   0.00 CutScore  99.45;  Ed  0, 0
ans =

    ' IL_49751.4  8SP9 C   99 G   86'

 matches the original group, cWW-cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          CUCCU*ACUUG (   1) MLPS  -8.10 deficit   0.84 prct   0.00 CutScore  92.53;  Ed  0, 0
ans =

    ' IL_49751.4  8VMA C   51 G   75'

 matches the original group, cWW-cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          CUCCU*ACUUG (   1) MLPS  -8.10 deficit   0.84 prct   0.00 CutScore  92.53;  Ed  0, 0
ans =

    ' IL_49751.4  8VMB C   51 G   72'

 matches the original group, cWW-cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          CCUUG*CUCCG (   1) MLPS  -8.78 deficit   1.52 prct   0.00 CutScore  86.59;  Ed  0, 0
ans =

    ' IL_49751.4  8S95 C  101 G   88'

 matches the original group, cWW-cWW-cWW-cWW-cWW
Better:   0 Equal:   0 Score 1.00          UUCUA*UUCUA (   1) MLPS  -8.93 deficit   1.67 prct   0.00 CutScore  85.20;  Ed  0, 0
ans =

    ' IL_49751.4  5BTM U   10 A   46'

 matches the original group, cWW-cWW-cWW-cWW-cWW
Better:   3 Equal:   0 Score 0.00          UUAUC*GGAUG (   1) MLPS -10.64 deficit   3.38 prct   0.00 CutScore  70.05;  Ed  0, 0
ans =

    ' IL_49751.4  7VYX U   37 G   25'

 scores better against   3 groups: IL_89021.2, 10 NTs, cWW-L-R-L-R-tHS-cWW                     , Ed  4, 1, MLPS -6.89, deficit  0.88, prct   0.00; IL_38507.2,  9 NTs, cWW-tWH-L-tHS-cWW                       , Ed  4, 1, MLPS -9.33, deficit  4.24, prct   0.00; IL_21001.1,  9 NTs, cWW-L-R-tHW-L-cWW                       , Ed  5, 3, MLPS -9.99, deficit  4.25, prct   0.00; 
Better:   2 Equal:   0 Score 0.00          GAUAC*GCAGC (   1) MLPS -10.70 deficit   3.43 prct   0.00 CutScore  69.59;  Ed  0, 0
ans =

    ' IL_49751.4  8D29 G    4 C   31'

 scores better against   2 groups: IL_63519.1,  9 NTs, cWW-cWW-L-R-cSH-cWW                     , Ed  0, 0, MLPS -6.32, deficit  0.00, prct   0.00; IL_58112.2,  8 NTs, cWW-cWW-L-R-cWW                         , Ed  4, 2, MLPS -9.39, deficit  2.32, prct   0.00; 
Better:   1 Equal:   0 Score 0.00          GUGCC*GACUU (   1) MLPS -10.74 deficit   3.48 prct   0.00 CutScore  69.23;  Ed  0, 0
ans =

    ' IL_49751.4  7VYX G   51 U   15'

 scores better against   1 groups: IL_61242.1, 10 NTs, cWW-cWW-L-R-L-R-cWW                     , Ed  7, 3, MLPS -10.37, deficit  5.13, prct   0.00; 
Better:   2 Equal:   0 Score 0.00          GGAAC*GGAAU (   1) MLPS -10.91 deficit   3.65 prct   0.00 CutScore  67.72;  Ed  0, 0
ans =

    ' IL_49751.4  4LFB G  713 U  677'

 scores better against   2 groups: IL_50730.2, 10 NTs, cWW-tSH-tHS-tHS-cWW                     , Ed  3, 1, MLPS -10.00, deficit  3.63, prct   0.00; IL_61440.1, 10 NTs, cWW-tSH-tHS-tWS-cWW                     , Ed  5, 1, MLPS -10.44, deficit  3.47, prct   0.00; 
Better:   2 Equal:   0 Score 0.00          GGAAU*AGAAU (   1) MLPS -10.96 deficit   3.70 prct   0.00 CutScore  67.25;  Ed  0, 0
ans =

    ' IL_49751.4  5J7L G  713 U  677'

 scores better against   2 groups: IL_50730.2, 10 NTs, cWW-tSH-tHS-tHS-cWW                     , Ed  2, 1, MLPS -10.09, deficit  3.71, prct   0.00; IL_61440.1, 10 NTs, cWW-tSH-tHS-tWS-cWW                     , Ed  5, 1, MLPS -10.46, deficit  3.49, prct   0.00; 
Better:   4 Equal:   0 Score 0.00         CCCCAG*CCCCG (   1) MLPS -13.77 deficit   6.51 prct   0.00 CutScore  42.38;  Ed  0, 0
ans =

    ' IL_49751.4  5VOE C    6 G   31'

 scores better against   4 groups: IL_12697.1, 10 NTs, cWW-cWW-L-R-tHS-cWW                     , Ed  8, 4, MLPS -10.26, deficit  2.33, prct   0.00; IL_80231.1, 11 NTs, cWW-L-R-L-R-L-R-tHS-cWW                 , Ed  6, 4, MLPS -10.60, deficit  1.48, prct   0.00; IL_97631.1, 11 NTs, cWW-L-R-L-R-L-tHS-cWW                   , Ed  8, 4, MLPS -10.67, deficit  3.64, prct   0.00; IL_25186.4, 10 NTs, cWW-L-R-L-R-L-R-cWW                     , Ed  5, 3, MLPS -13.14, deficit  7.40, prct   0.00; 
Better:   0 Equal:   0 Score 1.00          CCCAG*UAGGG (   1) MLPS -14.22 deficit   6.96 prct   0.00 CutScore  38.38;  Ed  0, 0
ans =

    ' IL_49751.4  4WF9 C 1768 G 1761'

 matches the original group, cWW-cWW-cWW-cWW-cWW
Better:   1 Equal:   0 Score 0.00          GCGUG*CACAC (   1) MLPS -12.26 deficit   5.00 prct   0.00 CutScore  55.77;  Ed  0, 0
ans =

    ' IL_49751.4  8P9A G 3284 C 3166'

 scores better against   1 groups: IL_61242.1, 10 NTs, cWW-cWW-L-R-L-R-cWW                     , Ed  6, 4, MLPS -11.04, deficit  5.80, prct   0.00; 
Group 101 is from IL_24254.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_24254.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-cWW-tHH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UUAGUAC*GGAAUA (   1) MLPS  -5.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_24254.1  1UN6 U   72 A  103'

 matches the original group, cWW-cWW-tHH-cSH-tWH-tHS-cWW
Group 385 is from IL_91920.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_91920.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-cWW-tHH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   2 Equal:   0 Score 0.00           GUAAG*UAUC (   1) MLPS  -4.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_91920.1  5J7L G 1202 C 1243'

 scores better against   2 groups: IL_67767.4,  9 NTs, cWW-tWH-cWW-cSH-cWW                     , Ed  2, 0, MLPS -4.45, deficit  0.31, prct   0.00; IL_53448.1,  8 NTs, cWW-tWH-cSH-cWW                         , Ed  2, 0, MLPS -4.47, deficit  0.44, prct   0.00; 
Group  18 is from IL_04346.10 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_04346.10
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CUCAGUAC*GGAACUG (   1) MLPS  -7.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04346.10  9DFE C  201 G  194'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUCAGUAC*GGAACUG (   1) MLPS  -7.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04346.10  7A0S C  178 G  171'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     AUGAGUAA*UGAAAUU (   1) MLPS  -8.09 deficit   0.15 prct   0.00 CutScore  99.24;  Ed  0, 0
ans =

    ' IL_04346.10  9DFE A 1262 U 2017'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     AUGAGUAA*UGAAAUU (   1) MLPS  -8.09 deficit   0.15 prct   0.00 CutScore  99.24;  Ed  0, 0
ans =

    ' IL_04346.10  7A0S A 1275 U 2000'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUCAGUAU*AGAACUG (   1) MLPS  -8.17 deficit   0.23 prct   0.00 CutScore  98.83;  Ed  0, 0
ans =

    ' IL_04346.10  4V9F C  171 G  164'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUAAGUAC*GGAACUG (   1) MLPS  -8.21 deficit   0.28 prct   0.00 CutScore  98.60;  Ed  0, 0
ans =

    ' IL_04346.10  5J7L C  201 G  194'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     AUAAGUAA*UGAAAUU (   1) MLPS  -8.60 deficit   0.67 prct   0.00 CutScore  96.66;  Ed  0, 0
ans =

    ' IL_04346.10  5J7L A 1262 U 2017'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUCAGUAC*GGAACCG (   1) MLPS  -9.42 deficit   1.48 prct   0.00 CutScore  92.60;  Ed  0, 0
ans =

    ' IL_04346.10  1JBR C    6 G   24'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUUAGUAC*GGAACCG (   1) MLPS  -9.47 deficit   1.53 prct   0.00 CutScore  92.33;  Ed  0, 0
ans =

    ' IL_04346.10  8CRE C 2990 G 3008'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     GUGAGUAG*UGAAAUC (   1) MLPS  -9.52 deficit   1.58 prct   0.00 CutScore  92.09;  Ed  0, 0
ans =

    ' IL_04346.10  4WF9 G 1300 C 2044'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUUAGUAG*CGAAACG (   1) MLPS  -9.66 deficit   1.72 prct   0.00 CutScore  91.39;  Ed  0, 0
ans =

    ' IL_04346.10  4WF9 C  241 G  262'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     GUUAGUAG*CGAACCC (   1) MLPS  -9.79 deficit   1.86 prct   0.00 CutScore  90.72;  Ed  0, 0
ans =

    ' IL_04346.10  7A0S G  215 C  236'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00     CUUAGUAC*GGAACAG (   1) MLPS -10.29 deficit   2.36 prct   0.00 CutScore  88.20;  Ed  0, 0
ans =

    ' IL_04346.10  8P9A C 3018 G 3036'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00    ACCGAGUAG*CGAAACU (   1) MLPS -11.39 deficit   3.46 prct   0.00 CutScore  82.71;  Ed  0, 0
ans =

    ' IL_04346.10  8OI5 A   72 U  106'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00    ACCGAGUAG*CGAAACU (   1) MLPS -11.39 deficit   3.46 prct   0.00 CutScore  82.71;  Ed  0, 0
ans =

    ' IL_04346.10  8P9A A   72 U  106'

 matches the original group, cWW-cWW-tSH-tHH-cSH-tWH-tHS-cWW
Group 332 is from IL_80926.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80926.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cWW-tSH-tHS-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GAGAAG*CAGUCC (   1) MLPS  -6.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80926.1  3BBM G    6 C    9'

 matches the original group, cWW-cWW-tSH-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00        GAGAAG*CAGUCC (   1) MLPS  -6.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80926.1  3GS8 G    6 C    9'

 matches the original group, cWW-cWW-tSH-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00        GAGAAG*CAGUCC (   1) MLPS  -6.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80926.1  1ZFT G    6 C    9'

 matches the original group, cWW-cWW-tSH-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00        GAGAAG*CAGUCC (   1) MLPS  -6.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80926.1  3GS5 G   18 C    9'

 matches the original group, cWW-cWW-tSH-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00        GAGAAG*CAGUCC (   1) MLPS  -6.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80926.1  1M5K G    6 C   16'

 matches the original group, cWW-cWW-tSH-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00        GAGAAG*CAGUCC (   1) MLPS  -6.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80926.1  1X9K G    6 C   10'

 matches the original group, cWW-cWW-tSH-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00        GAGAAG*CUGUCC (   1) MLPS  -6.83 deficit   0.48 prct   0.00 CutScore  97.50;  Ed  0, 0
ans =

    ' IL_80926.1  2NPY G    6 C    9'

 matches the original group, cWW-cWW-tSH-tHS-L-cWW
Group 243 is from IL_60797.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_60797.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-cWW-tSH-tHW-tHW-L-R-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GAGAAACAC*GGUACAUUACC (   1) MLPS  -9.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_60797.1  2P7E G   19 C   45'

 matches the original group, cWW-cWW-tSH-tHW-tHW-L-R-L-cWW-cWW
Better:   0 Equal:   0 Score 1.00 GAGAAACAC*GGUACAUUACC (   1) MLPS  -9.56 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_60797.1  3GS5 G   31 C   58'

 matches the original group, cWW-cWW-tSH-tHW-tHW-L-R-L-cWW-cWW
Better:   0 Equal:   0 Score 1.00 GAGAAACAC*GGUAUAUUACC (   1) MLPS -10.41 deficit   0.85 prct   0.00 CutScore  96.61;  Ed  0, 0
ans =

    ' IL_60797.1  1M5K G   19 C   64'

 matches the original group, cWW-cWW-tSH-tHW-tHW-L-R-L-cWW-cWW
Better:   0 Equal:   0 Score 1.00 GAGAAACAC*GGUCCAUUACC (   1) MLPS -11.69 deficit   2.13 prct   0.00 CutScore  91.47;  Ed  0, 0
ans =

    ' IL_60797.1  3BBM G   19 C   45'

 matches the original group, cWW-cWW-tSH-tHW-tHW-L-R-L-cWW-cWW
Group 263 is from IL_64900.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_64900.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cWW-tSS-tSH-L-tHS-R-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CCGAUGAAU*AUGAAG (   1) MLPS  -7.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_64900.1  6HCT C    2 G   18'

 matches the original group, cWW-cWW-tSS-tSH-L-tHS-R-cWW-L
Better:   0 Equal:   0 Score 1.00     CCGAUGAAU*AUGAAG (   1) MLPS  -7.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_64900.1  6HCT C    2 G   18'

 matches the original group, cWW-cWW-tSS-tSH-L-tHS-R-cWW-L
Better:   0 Equal:   0 Score 1.00     CCGAUGAAU*AUGAAG (   1) MLPS  -7.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_64900.1  6HCT C    2 G   18'

 matches the original group, cWW-cWW-tSS-tSH-L-tHS-R-cWW-L
Group 200 is from IL_49767.8 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_49767.8
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-cWW-tWH-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GAUAAC*GGAAGC (   1) MLPS  -6.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_49767.8  7A0S G 2717 C 2747'

 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00        GAUAAC*GGAAGC (   1) MLPS  -6.75 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_49767.8  9DFE G 2737 C 2767'

 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00        GGUAAG*CGAAAC (   1) MLPS  -6.84 deficit   0.09 prct   0.00 CutScore  99.41;  Ed  0, 0
ans =

    ' IL_49767.8  4V9F G 2772 C 2802'

 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00        GAUAAG*CGAAAC (   1) MLPS  -7.51 deficit   0.76 prct   0.00 CutScore  95.23;  Ed  0, 0
ans =

    ' IL_49767.8  5J7L G 2737 C 2767'

 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00        GAUAAG*UGAAGC (   1) MLPS  -7.53 deficit   0.78 prct   0.00 CutScore  95.07;  Ed  0, 0
ans =

    ' IL_49767.8  4WF9 G 2764 C 2794'

 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00        UCUAAA*UGAUGG (   1) MLPS -10.57 deficit   3.82 prct   0.00 CutScore  75.89;  Ed  0, 0
ans =

    ' IL_49767.8  7A0S U 1592 G 1436'

 matches the original group, cWW-cWW-tWH-L-tHS-cWW
Group 331 is from IL_80604.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80604.6
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-cWW-tWH-tWH-tHW-tHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     GGAUAAC*GCUAAUAC (   1) MLPS  -7.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80604.6  8CRE G  141 C  170'

 matches the original group, cWW-cWW-tWH-tWH-tHW-tHW-cWW
Better:   0 Equal:   0 Score 1.00     GGAUAAC*GCUAAUAC (   1) MLPS  -7.17 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80604.6  5J7L G  147 C  175'

 matches the original group, cWW-cWW-tWH-tWH-tHW-tHW-cWW
Better:   0 Equal:   0 Score 1.00     GUAUAAC*GCUAAUAC (   1) MLPS  -8.25 deficit   1.08 prct   0.00 CutScore  95.08;  Ed  0, 0
ans =

    ' IL_80604.6  8P9A G  143 C  172'

 matches the original group, cWW-cWW-tWH-tWH-tHW-tHW-cWW
Group 400 is from IL_96371.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_96371.1
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-tHH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             UAG*CGGG (   1) MLPS  -4.27 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_96371.1  6CK5 U   80 G   97'

 matches the original group, cWW-tHH-cWW
Group 346 is from IL_83150.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_83150.2
This group is considered to be structured ***************************
Number of NTs:  7  Signature: cWW-tHH-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            GGAAG*CGC (   1) MLPS  -5.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_83150.2  4WF9 G 1356 C 1370'

 matches the original group, cWW-tHH-cWW-L-L
Better:   0 Equal:   0 Score 1.00            GGAAG*CGC (   1) MLPS  -5.85 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_83150.2  7A0S G 1332 C 1346'

 matches the original group, cWW-tHH-cWW-L-L
Better:   0 Equal:   0 Score 1.00           UAAUU*ACCA (   1) MLPS  -6.15 deficit   0.31 prct   0.00 CutScore  96.83;  Ed  0, 0
ans =

    ' IL_83150.2  8P9A U 3047 A 3094'

 matches the original group, cWW-tHH-cWW-L-L
Better:   0 Equal:   0 Score 1.00           UAAUU*ACCA (   1) MLPS  -6.15 deficit   0.31 prct   0.00 CutScore  96.83;  Ed  0, 0
ans =

    ' IL_83150.2  8CRE U 3019 A 3066'

 matches the original group, cWW-tHH-cWW-L-L
Group 279 is from IL_68574.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_68574.4
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UAAG*CGAUG (   1) MLPS  -5.80 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_68574.4  9DFE U 1240 G 1206'

 matches the original group, cWW-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           UAAG*UGAUG (   1) MLPS  -5.97 deficit   0.18 prct   0.00 CutScore  98.57;  Ed  0, 0
ans =

    ' IL_68574.4  5J7L U 1468 G 1524'

 matches the original group, cWW-tHH-tHS-cWW
Better:   3 Equal:   0 Score 0.00           CACC*GCAAG (   1) MLPS  -8.46 deficit   2.66 prct   0.00 CutScore  78.72;  Ed  0, 0
ans =

    ' IL_68574.4  3BNR C    5 G   19'

 scores better against   3 groups: IL_71598.1,  8 NTs, cWW-tSH-L-cWW-L                         , Ed  4, 2, MLPS -6.50, deficit  0.28, prct   0.00; IL_64231.5,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  0, 0, MLPS -7.64, deficit  0.96, prct   0.00; IL_26222.2,  9 NTs, cWW-cWS-cSH-tWH-R-L-R-cWW               , Ed  4, 2, MLPS -8.35, deficit  6.15, prct   0.00; 
Group 357 is from IL_85599.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85599.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00             UAG*UGGG (   1) MLPS  -4.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85599.2  5J7L U 2081 G 2239'

 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00             UAG*UGGG (   1) MLPS  -4.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85599.2  8CRE U 2401 G 2579'

 matches the original group, cWW-tHS-cWW
Better:   0 Equal:   0 Score 1.00             UAG*UGGG (   1) MLPS  -4.86 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85599.2  8P9A U 2423 G 2607'

 matches the original group, cWW-tHS-cWW
Better:   1 Equal:   0 Score 0.00             UAG*CGGG (   1) MLPS  -5.00 deficit   0.14 prct   0.00 CutScore  98.53;  Ed  0, 0
ans =

    ' IL_85599.2  7A0S U 2064 G 2218'

 scores better against   1 groups: IL_96371.1,  6 NTs, cWW-tHH-cWW                             , Ed  0, 0, MLPS -4.27, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             UAG*CGGG (   1) MLPS  -5.00 deficit   0.14 prct   0.00 CutScore  98.53;  Ed  0, 0
ans =

    ' IL_85599.2  4WF9 U 2108 G 2266'

 scores better against   1 groups: IL_96371.1,  6 NTs, cWW-tHH-cWW                             , Ed  0, 0, MLPS -4.27, deficit  0.00, prct   0.00; 
Better:   0 Equal:   0 Score 1.00             CAG*UGGG (   1) MLPS  -5.68 deficit   0.82 prct   0.00 CutScore  91.40;  Ed  0, 0
ans =

    ' IL_85599.2  9DFE C  288 G  353'

 matches the original group, cWW-tHS-cWW
Better:   1 Equal:   0 Score 0.00             CAG*CGGG (   1) MLPS  -5.81 deficit   0.96 prct   0.00 CutScore  89.94;  Ed  0, 0
ans =

    ' IL_85599.2  9DFE C 2081 G 2239'

 scores better against   1 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 2, MLPS -5.58, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00             CAG*CGGG (   1) MLPS  -5.81 deficit   0.96 prct   0.00 CutScore  89.94;  Ed  0, 0
ans =

    ' IL_85599.2  4V9F C 2122 G 2272'

 scores better against   1 groups: IL_90351.1,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 2, MLPS -5.58, deficit  0.00, prct   0.00; 
Better:   4 Equal:   0 Score 0.00              UAU*AGG (   1) MLPS  -7.10 deficit   2.24 prct   0.00 CutScore  76.41;  Ed  0, 0
ans =

    ' IL_85599.2  1L9A U  132 G  165'

 scores better against   4 groups: IL_14688.1,  6 NTs, cWW-cWW-cWW                             , Ed  3, 2, MLPS -6.27, deficit  0.29, prct   0.00; IL_10167.6,  6 NTs, cWW-cHW-cWW                             , Ed  2, 0, MLPS -6.60, deficit  3.62, prct   0.00; IL_96371.1,  6 NTs, cWW-tHH-cWW                             , Ed  3, 1, MLPS -6.66, deficit  2.40, prct   0.00; IL_44465.1,  6 NTs, cWW-L-R-cWW                             , Ed  2, 0, MLPS -6.97, deficit  3.00, prct   0.00; 
Group  27 is from IL_06136.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_06136.2
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tHS-cWW-tHS-tSH-tSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGGAAC*GGGAAC (   1) MLPS  -9.55 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_06136.2  3FTF G 1515 C 1520'

 matches the original group, cWW-tHS-cWW-tHS-tSH-tSH-cWW
Better:   0 Equal:   0 Score 1.00        GGGAAC*GGGAAC (   1) MLPS  -9.55 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_06136.2  3FTE G 1515 C 1520'

 matches the original group, cWW-tHS-cWW-tHS-tSH-tSH-cWW
Better:   0 Equal:   0 Score 1.00        GGGAAC*GGGAAC (   1) MLPS  -9.55 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_06136.2  3R9W G 1515 C 1520'

 matches the original group, cWW-tHS-cWW-tHS-tSH-tSH-cWW
Better:   0 Equal:   0 Score 1.00        CGGAUG*CGGAUG (   1) MLPS  -9.85 deficit   0.29 prct   0.00 CutScore  97.99;  Ed  0, 0
ans =

    ' IL_06136.2  5LR4 C    3 G    8'

 matches the original group, cWW-tHS-cWW-tHS-tSH-tSH-cWW
Better:   0 Equal:   0 Score 1.00        CGGAUG*CGGAUG (   1) MLPS  -9.85 deficit   0.29 prct   0.00 CutScore  97.99;  Ed  0, 0
ans =

    ' IL_06136.2  5LR3 C    3 G    8'

 matches the original group, cWW-tHS-cWW-tHS-tSH-tSH-cWW
Better:   1 Equal:   0 Score 0.00        GCGGAG*UGAAAC (   1) MLPS -12.79 deficit   3.23 prct   0.00 CutScore  77.73;  Ed  0, 0
ans =

    ' IL_06136.2  7A0S G  736 C  721'

 scores better against   1 groups: IL_71294.3, 12 NTs, cWW-L-R-L-R-L-R-L-R-cWW                 , Ed  8, 4, MLPS -12.75, deficit  4.82, prct   0.00; 
Group 361 is from IL_86012.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_86012.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tHS-tWH-cWH-cWW-L-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    UCUGUGAUG*UGCAUGG (   1) MLPS  -8.25 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_86012.1  8P9A U 1430 G 1278'

 matches the original group, cWW-tHS-tWH-cWH-cWW-L-L-cWW
Group 402 is from IL_96788.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_96788.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tHW-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GAGGU*AAGUC (   1) MLPS  -4.34 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_96788.1  3IGI G  267 C  286'

 matches the original group, cWW-tHW-tHS-cWW-cWW
Group 370 is from IL_88116.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_88116.2
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-tSH-L-R-L-R-L-R-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UCAAAGU*AACCAAG (   1) MLPS  -8.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88116.2  8P9A U 2211 G 2234'

 matches the original group, cWW-tSH-L-R-L-R-L-R-cWW-cWW
Better:   0 Equal:   0 Score 1.00      UCAAAGU*AACCAAG (   1) MLPS  -8.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88116.2  8CRE U 2189 G 2212'

 matches the original group, cWW-tSH-L-R-L-R-L-R-cWW-cWW
Better:   0 Equal:   0 Score 1.00      UGAACAC*GACGAAG (   1) MLPS  -9.95 deficit   1.41 prct   0.00 CutScore  92.95;  Ed  0, 0
ans =

    ' IL_88116.2  4V9F U 1907 G 1932'

 matches the original group, cWW-tSH-L-R-L-R-L-R-cWW-cWW
Group 359 is from IL_85652.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85652.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-L-R-L-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UGAACCG*CAAAA (   1) MLPS  -7.60 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85652.1  1MFQ U  181 A  216'

 matches the original group, cWW-tSH-L-R-L-R-L-cWW-L
Group 358 is from IL_85630.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85630.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-tSH-L-R-L-R-L-cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     UGCAUCCGC*GAGUAG (   1) MLPS  -9.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85630.1  4LVW U   77 G    9'

 matches the original group, cWW-tSH-L-R-L-R-L-cWW-L-cWW-L
Group  92 is from IL_21667.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21667.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UAUAAG*UGAAA (   1) MLPS  -6.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_21667.1  8P9A U   64 A   86'

 matches the original group, cWW-tSH-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00         UAUAAG*UGAAA (   1) MLPS  -6.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_21667.1  8CRE U   64 A   86'

 matches the original group, cWW-tSH-L-R-L-cWW
Group 319 is from IL_77691.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_77691.5
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tSH-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CGAAG*UUAG (   1) MLPS  -6.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77691.5  5J7L C 1874 G 1867'

 matches the original group, cWW-tSH-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           CGAAG*UUAG (   1) MLPS  -6.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77691.5  4WF9 C 1901 G 1894'

 matches the original group, cWW-tSH-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           CAAAG*UGAG (   1) MLPS  -6.97 deficit   0.25 prct   0.00 CutScore  97.47;  Ed  0, 0
ans =

    ' IL_77691.5  3IGI C  190 G  175'

 matches the original group, cWW-tSH-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           CGGAA*UGAG (   1) MLPS  -7.20 deficit   0.47 prct   0.00 CutScore  95.18;  Ed  0, 0
ans =

    ' IL_77691.5  3FS0 C   -1 G   49'

 matches the original group, cWW-tSH-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           CGGAA*UGAG (   1) MLPS  -7.20 deficit   0.47 prct   0.00 CutScore  95.18;  Ed  0, 0
ans =

    ' IL_77691.5  3FTM C   -1 G   49'

 matches the original group, cWW-tSH-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           GAAAG*UAAC (   1) MLPS  -7.42 deficit   0.69 prct   0.00 CutScore  92.90;  Ed  0, 0
ans =

    ' IL_77691.5  2R8S G  112 C  208'

 matches the original group, cWW-tSH-L-R-L-cWW
Better:   0 Equal:   0 Score 1.00           CGAAG*CGAG (   1) MLPS  -7.46 deficit   0.74 prct   0.00 CutScore  92.44;  Ed  0, 0
ans =

    ' IL_77691.5  4LFB C 1431 G 1469'

 matches the original group, cWW-tSH-L-R-L-cWW
Group 383 is from IL_91636.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_91636.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-L-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GGGAACC*GUGC (   1) MLPS  -5.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_91636.1  3KTW G  193 C  227'

 matches the original group, cWW-tSH-L-R-L-cWW-L-L
Group 192 is from IL_47346.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_47346.2
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-L-R-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CGUAAC*GGAGAAG (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_47346.2  9DFE C 1686 G 1702'

 matches the original group, cWW-tSH-L-R-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUAAC*GGAGAAG (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_47346.2  5J7L C 1686 G 1702'

 matches the original group, cWW-tSH-L-R-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUAAC*GGAGAAG (   1) MLPS  -6.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_47346.2  4WF9 C 1730 G 1746'

 matches the original group, cWW-tSH-L-R-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUACC*GAAGAAG (   1) MLPS  -6.55 deficit   0.42 prct   0.00 CutScore  97.73;  Ed  0, 0
ans =

    ' IL_47346.2  4V9F C 1764 G 1780'

 matches the original group, cWW-tSH-L-R-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUAAC*GAAGAAG (   1) MLPS  -6.61 deficit   0.48 prct   0.00 CutScore  97.39;  Ed  0, 0
ans =

    ' IL_47346.2  7A0S C 1703 G 1719'

 matches the original group, cWW-tSH-L-R-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUAAC*GGAUAAG (   1) MLPS  -6.92 deficit   0.79 prct   0.00 CutScore  95.70;  Ed  0, 0
ans =

    ' IL_47346.2  8CRE C 1914 G 1930'

 matches the original group, cWW-tSH-L-R-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUAAC*GGAUAAG (   1) MLPS  -6.92 deficit   0.79 prct   0.00 CutScore  95.70;  Ed  0, 0
ans =

    ' IL_47346.2  8P9A C 1918 G 1934'

 matches the original group, cWW-tSH-L-R-tHH-tHS-cWW
Group 356 is from IL_85536.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_85536.2
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-L-R-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00        CGGAUU*AUGAAG (   1) MLPS  -8.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85536.2  4LFB C 1303 G 1334'

 scores better against   1 groups: IL_80926.1, 11 NTs, cWW-cWW-tSH-tHS-L-cWW                   , Ed  6, 4, MLPS -8.23, deficit  1.88, prct   0.00; 
Better:   1 Equal:   0 Score 0.00        CGGAUU*AUGAAG (   1) MLPS  -8.93 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_85536.2  5J7L C 1303 G 1334'

 scores better against   1 groups: IL_80926.1, 11 NTs, cWW-cWW-tSH-tHS-L-cWW                   , Ed  6, 4, MLPS -8.23, deficit  1.88, prct   0.00; 
Better:   0 Equal:   0 Score 1.00        CGGAUG*CUGAUG (   1) MLPS  -9.04 deficit   0.11 prct   0.00 CutScore  99.31;  Ed  0, 0
ans =

    ' IL_85536.2  8P9A C  768 G  763'

 matches the original group, cWW-tSH-L-R-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        CGGAUG*CUGAUG (   1) MLPS  -9.04 deficit   0.11 prct   0.00 CutScore  99.31;  Ed  0, 0
ans =

    ' IL_85536.2  8CRE C  764 G  759'

 matches the original group, cWW-tSH-L-R-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        GGGAUA*UUCAAC (   1) MLPS  -9.21 deficit   0.27 prct   0.00 CutScore  98.29;  Ed  0, 0
ans =

    ' IL_85536.2  8CRE G 1527 C 1558'

 matches the original group, cWW-tSH-L-R-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        GGGAUA*UUCAAC (   1) MLPS  -9.21 deficit   0.27 prct   0.00 CutScore  98.29;  Ed  0, 0
ans =

    ' IL_85536.2  8P9A G 1540 C 1571'

 matches the original group, cWW-tSH-L-R-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00      UAAUCAC*GGAACUG (   1) MLPS -20.61 deficit  11.68 prct   0.00 CutScore  27.55;  Ed  0, 0
ans =

    ' IL_85536.2  6AAY U   49 G   32'

 matches the original group, cWW-tSH-L-R-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        GCUAAC*GCGAAC (   1) MLPS -11.26 deficit   2.33 prct   0.00 CutScore  85.52;  Ed  0, 0
ans =

    ' IL_85536.2  8P9A G  703 C  735'

 matches the original group, cWW-tSH-L-R-tHS-cWW-cWW
Group 286 is from IL_69543.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_69543.3
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-L-R-tSS-tHS-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CGGAAUU*GGAGAUG (   1) MLPS  -8.30 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_69543.3  8P9A C 1711 G 1733'

 matches the original group, cWW-tSH-L-R-tSS-tHS-L-R-cWW
Better:   0 Equal:   0 Score 1.00      UGGAAUU*GGAGAUG (   1) MLPS  -8.53 deficit   0.23 prct   0.00 CutScore  98.83;  Ed  0, 0
ans =

    ' IL_69543.3  8CRE U 1707 G 1729'

 matches the original group, cWW-tSH-L-R-tSS-tHS-L-R-cWW
Better:   0 Equal:   0 Score 1.00      CAGAGAA*UGUGAGG (   1) MLPS -12.23 deficit   3.93 prct   0.00 CutScore  79.75;  Ed  0, 0
ans =

    ' IL_69543.3  9L6X C    6 G   31'

 matches the original group, cWW-tSH-L-R-tSS-tHS-L-R-cWW
Group 376 is from IL_89312.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_89312.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-L-cWS-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UGAAGGAAG*CAAG (   1) MLPS  -9.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_89312.1  3IGI U  103 G   79'

 matches the original group, cWW-tSH-L-cWS-cWW-L
Group 252 is from IL_61476.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_61476.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSH-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            AGUAG*CAU (   1) MLPS  -5.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61476.2  8P9A A 2686 U 2668'

 matches the original group, cWW-tSH-L-cWW-L
Better:   0 Equal:   0 Score 1.00            AGUAG*CAU (   1) MLPS  -5.03 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61476.2  8CRE A 2658 U 2640'

 matches the original group, cWW-tSH-L-cWW-L
Better:   0 Equal:   0 Score 1.00            UGUAG*CAA (   1) MLPS  -5.12 deficit   0.09 prct   0.00 CutScore  99.13;  Ed  0, 0
ans =

    ' IL_61476.2  7A0S U 2296 A 2278'

 matches the original group, cWW-tSH-L-cWW-L
Better:   0 Equal:   0 Score 1.00            CGGAG*CAG (   1) MLPS  -5.62 deficit   0.59 prct   0.00 CutScore  94.61;  Ed  0, 0
ans =

    ' IL_61476.2  9DFE C 2317 G 2299'

 matches the original group, cWW-tSH-L-cWW-L
Better:   0 Equal:   0 Score 1.00            CAUAG*CAG (   1) MLPS  -5.98 deficit   0.95 prct   0.00 CutScore  91.24;  Ed  0, 0
ans =

    ' IL_61476.2  4WF9 C 2344 G 2326'

 matches the original group, cWW-tSH-L-cWW-L
Better:   0 Equal:   0 Score 1.00            CGAAG*CAG (   1) MLPS  -6.13 deficit   1.10 prct   0.00 CutScore  89.92;  Ed  0, 0
ans =

    ' IL_61476.2  4V9F C 2351 G 2333'

 matches the original group, cWW-tSH-L-cWW-L
Better:   2 Equal:   0 Score 0.00            AGGUU*AAU (   1) MLPS  -7.32 deficit   2.29 prct   0.00 CutScore  78.95;  Ed  0, 0
ans =

    ' IL_61476.2  5J7L A 2317 U 2299'

 scores better against   2 groups: IL_47972.1,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  5, 1, MLPS -6.65, deficit  1.29, prct   0.00; IL_36516.3,  8 NTs, cWW-cWW-cSH-cWW-L                       , Ed  3, 1, MLPS -6.87, deficit  0.60, prct   0.00; 
Group 297 is from IL_71598.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_71598.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSH-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGAAA*UAAC (   1) MLPS  -6.22 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_71598.1  6D3P G   32 C    9'

 matches the original group, cWW-tSH-L-cWW-L
Group 362 is from IL_86136.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_86136.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-L-cWW-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CGAGGAAC*GAG (   1) MLPS  -6.58 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_86136.1  8CRE C  534 G  514'

 matches the original group, cWW-tSH-L-cWW-L-L-R-L
Group 291 is from IL_70411.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70411.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-L-tHH-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UGUAAG*UUGAG (   1) MLPS  -5.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70411.2  5J7L U 2847 G 2869'

 matches the original group, cWW-tSH-L-tHH-L-cWW
Better:   0 Equal:   0 Score 1.00         UGUAAG*UUGAG (   1) MLPS  -5.49 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70411.2  9DFE U 2847 G 2869'

 matches the original group, cWW-tSH-L-tHH-L-cWW
Better:   0 Equal:   0 Score 1.00         UGUAAG*CUGAG (   1) MLPS  -6.46 deficit   0.97 prct   0.00 CutScore  94.22;  Ed  0, 0
ans =

    ' IL_70411.2  8CRE U 3297 G 3336'

 matches the original group, cWW-tSH-L-tHH-L-cWW
Better:   0 Equal:   0 Score 1.00         UGUAAG*CUGAG (   1) MLPS  -6.46 deficit   0.97 prct   0.00 CutScore  94.22;  Ed  0, 0
ans =

    ' IL_70411.2  8P9A U 3332 G 3371'

 matches the original group, cWW-tSH-L-tHH-L-cWW
Better:   0 Equal:   0 Score 1.00         UGGAAG*UGGAG (   1) MLPS  -8.06 deficit   2.57 prct   0.00 CutScore  84.75;  Ed  0, 0
ans =

    ' IL_70411.2  4WF9 U 2867 G 2889'

 matches the original group, cWW-tSH-L-tHH-L-cWW
Better:   0 Equal:   0 Score 1.00         UGCACG*UUCAG (   1) MLPS  -8.46 deficit   2.97 prct   0.00 CutScore  82.37;  Ed  0, 0
ans =

    ' IL_70411.2  7A0S U 2822 G 2844'

 matches the original group, cWW-tSH-L-tHH-L-cWW
Better:   0 Equal:   0 Score 1.00         UGUGCG*UUAAG (   1) MLPS  -8.64 deficit   3.15 prct   0.00 CutScore  81.31;  Ed  0, 0
ans =

    ' IL_70411.2  4V9F U 2864 G 2892'

 matches the original group, cWW-tSH-L-tHH-L-cWW
Group 176 is from IL_43858.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_43858.1
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-tSH-cSH-tWH-cSH-cHW-cWH-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   UGUUAUAGC*GAAUGUGG (   1) MLPS  -8.00 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_43858.1  8CRE U  551 G  534'

 matches the original group, cWW-tSH-cSH-tWH-cSH-cHW-cWH-cWW-cWW
Better:   0 Equal:   0 Score 1.00   UAUUAUAGC*GAAUGUAG (   1) MLPS  -8.37 deficit   0.37 prct   0.00 CutScore  98.46;  Ed  0, 0
ans =

    ' IL_43858.1  8P9A U  553 G  538'

 matches the original group, cWW-tSH-cSH-tWH-cSH-cHW-cWH-cWW-cWW
Group 203 is from IL_50694.7 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_50694.7
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-tSH-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              CGAC*GG (   1) MLPS  -3.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_50694.7  6N5P C   94 G   45'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              CGUC*GG (   1) MLPS  -3.57 deficit   0.07 prct   0.00 CutScore  99.25;  Ed  0, 0
ans =

    ' IL_50694.7  4QLM C   91 G   40'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              CGUC*GG (   1) MLPS  -3.57 deficit   0.07 prct   0.00 CutScore  99.25;  Ed  0, 0
ans =

    ' IL_50694.7  4W90 C   96 G   59'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              CGUC*GG (   1) MLPS  -3.57 deficit   0.07 prct   0.00 CutScore  99.25;  Ed  0, 0
ans =

    ' IL_50694.7  4QK9 C   93 G   44'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              UGAC*GA (   1) MLPS  -3.65 deficit   0.15 prct   0.00 CutScore  98.39;  Ed  0, 0
ans =

    ' IL_50694.7  4LFB U  751 A  655'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              UGAC*GA (   1) MLPS  -3.65 deficit   0.15 prct   0.00 CutScore  98.39;  Ed  0, 0
ans =

    ' IL_50694.7  5J7L U  751 A  655'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              UGAC*GA (   1) MLPS  -3.65 deficit   0.15 prct   0.00 CutScore  98.39;  Ed  0, 0
ans =

    ' IL_50694.7  1G1X U  751 A  655'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              UGAC*GA (   1) MLPS  -3.65 deficit   0.15 prct   0.00 CutScore  98.39;  Ed  0, 0
ans =

    ' IL_50694.7  1KUQ U   50 A   19'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              UGAC*GA (   1) MLPS  -3.65 deficit   0.15 prct   0.00 CutScore  98.39;  Ed  0, 0
ans =

    ' IL_50694.7  1G1X U  751 A  655'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGAA*UC (   1) MLPS  -4.09 deficit   0.59 prct   0.00 CutScore  93.75;  Ed  0, 0
ans =

    ' IL_50694.7  9DFE G 1666 C 1994'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGAA*UC (   1) MLPS  -4.09 deficit   0.59 prct   0.00 CutScore  93.75;  Ed  0, 0
ans =

    ' IL_50694.7  5J7L G 1666 C 1994'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGAA*UC (   1) MLPS  -4.09 deficit   0.59 prct   0.00 CutScore  93.75;  Ed  0, 0
ans =

    ' IL_50694.7  4WF9 G 1710 C 2021'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGAA*UC (   1) MLPS  -4.09 deficit   0.59 prct   0.00 CutScore  93.75;  Ed  0, 0
ans =

    ' IL_50694.7  4V9F G 1744 C 2035'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGAA*UC (   1) MLPS  -4.09 deficit   0.59 prct   0.00 CutScore  93.75;  Ed  0, 0
ans =

    ' IL_50694.7  8P9A G 1898 C 2337'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGAA*UC (   1) MLPS  -4.09 deficit   0.59 prct   0.00 CutScore  93.75;  Ed  0, 0
ans =

    ' IL_50694.7  7A0S G 1683 C 1977'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGAA*UC (   1) MLPS  -4.09 deficit   0.59 prct   0.00 CutScore  93.75;  Ed  0, 0
ans =

    ' IL_50694.7  8CRE G 1894 C 2315'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              CGAA*UG (   1) MLPS  -4.19 deficit   0.69 prct   0.00 CutScore  92.72;  Ed  0, 0
ans =

    ' IL_50694.7  4V9F C  245 G  266'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGUU*AC (   1) MLPS  -4.31 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0
ans =

    ' IL_50694.7  9DFE G 1310 C 1604'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGUU*AC (   1) MLPS  -4.31 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0
ans =

    ' IL_50694.7  5J7L G 1310 C 1604'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGUU*AC (   1) MLPS  -4.31 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0
ans =

    ' IL_50694.7  4V9F G 1416 C 1679'

 matches the original group, cWW-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00              GGUU*AC (   1) MLPS  -4.31 deficit   0.81 prct   0.00 CutScore  91.44;  Ed  0, 0
ans =

    ' IL_50694.7  7A0S G 1323 C 1620'

 matches the original group, cWW-tSH-cWW-L
Better:   2 Equal:   0 Score 0.00              GUUU*AC (   1) MLPS  -4.73 deficit   1.24 prct   0.00 CutScore  86.96;  Ed  0, 0
ans =

    ' IL_50694.7  4WF9 G 1347 C 1648'

 scores better against   2 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.22, deficit  0.06, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  1, 0, MLPS -4.62, deficit  0.34, prct   0.00; 
Better:   2 Equal:   0 Score 0.00              CAUU*AG (   1) MLPS  -5.47 deficit   1.97 prct   0.00 CutScore  79.22;  Ed  0, 0
ans =

    ' IL_50694.7  8P9A C  962 G  866'

 scores better against   2 groups: IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  3, 0, MLPS -4.66, deficit  0.23, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  2, 0, MLPS -5.15, deficit  0.12, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              CAUC*GG (   1) MLPS  -5.72 deficit   2.22 prct   0.00 CutScore  76.61;  Ed  0, 0
ans =

    ' IL_50694.7  3D0U C   35 G   52'

 scores better against   5 groups: IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  1, 0, MLPS -4.50, deficit  0.06, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -5.15, deficit  0.12, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  1, 1, MLPS -5.54, deficit  2.80, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -5.54, deficit  1.61, prct   0.00; IL_95583.2,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -5.55, deficit  1.71, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              CAUC*GG (   1) MLPS  -5.72 deficit   2.22 prct   0.00 CutScore  76.61;  Ed  0, 0
ans =

    ' IL_50694.7  3DIL C   38 G   55'

 scores better against   5 groups: IL_76709.2,  6 NTs, cWW-L-cWW-L                             , Ed  1, 0, MLPS -4.50, deficit  0.06, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  4, 0, MLPS -5.15, deficit  0.12, prct   0.00; IL_51454.3,  5 NTs, cWW-cSH-cWW                             , Ed  1, 1, MLPS -5.54, deficit  2.80, prct   0.00; IL_73355.1,  6 NTs, cWW-L-cWW-L                             , Ed  1, 1, MLPS -5.54, deficit  1.61, prct   0.00; IL_95583.2,  5 NTs, cWW-L-cWW                               , Ed  1, 1, MLPS -5.55, deficit  1.71, prct   0.00; 
Better:   1 Equal:   0 Score 0.00              UGUU*AG (   1) MLPS  -6.13 deficit   2.63 prct   0.00 CutScore  72.31;  Ed  0, 0
ans =

    ' IL_50694.7  7A0S U  857 G  945'

 scores better against   1 groups: IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  1, 0, MLPS -5.71, deficit  0.99, prct   0.00; 
Better:   5 Equal:   0 Score 0.00              CUUC*GG (   1) MLPS  -6.32 deficit   2.83 prct   0.00 CutScore  70.23;  Ed  0, 0
ans =

    ' IL_50694.7  1NTA C   15 G  111'

 scores better against   5 groups: IL_56987.1,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -4.21, deficit  0.05, prct   0.00; IL_84476.1,  4 NTs, cWW-cWW                                 , Ed  3, 0, MLPS -4.59, deficit  0.31, prct   0.00; IL_79895.1,  6 NTs, cWW-L-cWW-L                             , Ed  3, 1, MLPS -5.15, deficit  0.12, prct   0.00; IL_66635.5,  5 NTs, cWW-L-cWW                               , Ed  2, 0, MLPS -5.82, deficit  1.10, prct   0.00; IL_73452.2,  5 NTs, cWW-L-cWW                               , Ed  3, 1, MLPS -6.14, deficit  0.56, prct   0.00; 
Group 403 is from IL_97273.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_97273.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tSH-cWW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGGAUC*GUC (   1) MLPS  -4.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_97273.1  8P9A G  985 C 1016'

 matches the original group, cWW-tSH-cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00           GGGAUC*GUC (   1) MLPS  -4.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_97273.1  8CRE G  970 C 1001'

 matches the original group, cWW-tSH-cWW-L-cWW-L
Better:   0 Equal:   0 Score 1.00           GGUGCU*AAC (   1) MLPS  -7.43 deficit   2.98 prct   0.00 CutScore  78.81;  Ed  0, 0
ans =

    ' IL_97273.1  3AGV G    4 C   20'

 matches the original group, cWW-tSH-cWW-L-cWW-L
Group  34 is from IL_07469.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_07469.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-cWW-cSH-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UAAGCG*CAUA (   1) MLPS  -3.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07469.2  8P9A U 2909 A 2892'

 matches the original group, cWW-tSH-cWW-cSH-R-cWW
Better:   0 Equal:   0 Score 1.00          UAAGCG*CAUA (   1) MLPS  -3.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_07469.2  8CRE U 2881 A 2864'

 matches the original group, cWW-tSH-cWW-cSH-R-cWW
Better:   0 Equal:   0 Score 1.00          AGUGCG*CGUU (   1) MLPS -10.45 deficit   6.92 prct   0.00 CutScore  62.95;  Ed  0, 0
ans =

    ' IL_07469.2  8P9A A  238 U  178'

 matches the original group, cWW-tSH-cWW-cSH-R-cWW
Group  97 is from IL_22854.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_22854.4
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-tSH-cWW-tHW-R-L-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GGAACUCGG*CUGUC (   1) MLPS  -5.26 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_22854.4  4WF9 G 1710 C 2021'

 matches the original group, cWW-tSH-cWW-tHW-R-L-cWW-L-L-R
Better:   0 Equal:   0 Score 1.00      GGAAGUCGG*CUGUC (   1) MLPS  -5.94 deficit   0.68 prct   0.00 CutScore  96.62;  Ed  0, 0
ans =

    ' IL_22854.4  8CRE G 1894 C 2315'

 matches the original group, cWW-tSH-cWW-tHW-R-L-cWW-L-L-R
Better:   0 Equal:   0 Score 1.00      GGAAGUCGG*CUGUC (   1) MLPS  -5.94 deficit   0.68 prct   0.00 CutScore  96.62;  Ed  0, 0
ans =

    ' IL_22854.4  8P9A G 1898 C 2337'

 matches the original group, cWW-tSH-cWW-tHW-R-L-cWW-L-L-R
Better:   0 Equal:   0 Score 1.00      GGAACUCUG*CUGUC (   1) MLPS  -6.05 deficit   0.79 prct   0.00 CutScore  96.06;  Ed  0, 0
ans =

    ' IL_22854.4  9DFE G 1666 C 1994'

 matches the original group, cWW-tSH-cWW-tHW-R-L-cWW-L-L-R
Better:   0 Equal:   0 Score 1.00      GGAACUAGG*CUGUC (   1) MLPS  -6.56 deficit   1.30 prct   0.00 CutScore  93.50;  Ed  0, 0
ans =

    ' IL_22854.4  5J7L G 1666 C 1994'

 matches the original group, cWW-tSH-cWW-tHW-R-L-cWW-L-L-R
Better:   0 Equal:   0 Score 1.00      GGAAUUCGG*CUGUC (   1) MLPS  -6.60 deficit   1.34 prct   0.00 CutScore  93.32;  Ed  0, 0
ans =

    ' IL_22854.4  4V9F G 1744 C 2035'

 matches the original group, cWW-tSH-cWW-tHW-R-L-cWW-L-L-R
Better:   0 Equal:   0 Score 1.00      GGAACUUUG*CUGUC (   1) MLPS  -7.35 deficit   2.09 prct   0.00 CutScore  89.56;  Ed  0, 0
ans =

    ' IL_22854.4  7A0S G 1683 C 1977'

 matches the original group, cWW-tSH-cWW-tHW-R-L-cWW-L-L-R
Group 345 is from IL_83149.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_83149.1
This group is considered to be structured ***************************
Number of NTs: 24  Signature: cWW-tSH-tHH-L-R-L-R-L-R-L-R-L-R-L-R-L-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 UGAAAAUGGAUGGCGC*GACACCACAAAA (   1) MLPS -14.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_83149.1  8CRE U 1295 A 1201'

 matches the original group, cWW-tSH-tHH-L-R-L-R-L-R-L-R-L-R-L-R-L-cWW-L-cWW
Better:   0 Equal:   0 Score 1.00 UGAAAAUGGAUGGCGC*GACACCACAAAA (   1) MLPS -14.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_83149.1  8P9A U 1299 A 1205'

 matches the original group, cWW-tSH-tHH-L-R-L-R-L-R-L-R-L-R-L-R-L-cWW-L-cWW
Group 204 is from IL_50715.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_50715.3
This group is considered to be structured ***************************
Number of NTs: 21  Signature: cWW-tSH-tHH-L-R-L-R-L-tWW-L-cWW-L-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CGAAAAUGAUCGGGGC*GGUAAAG (   1) MLPS -14.88 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_50715.3  9DFE C 1124 G 1030'

 matches the original group, cWW-tSH-tHH-L-R-L-R-L-tWW-L-cWW-L-L-L-R-L
Better:   0 Equal:   0 Score 1.00 CGAAAAUGAUCGGGGC*GGUUAAG (   1) MLPS -15.73 deficit   0.85 prct   0.00 CutScore  96.61;  Ed  0, 0
ans =

    ' IL_50715.3  7A0S C 1135 G 1041'

 matches the original group, cWW-tSH-tHH-L-R-L-R-L-tWW-L-cWW-L-L-L-R-L
Better:   0 Equal:   0 Score 1.00 CGAAAAUGUACCGGGGC*GGAAAAG (   1) MLPS -16.88 deficit   2.00 prct   0.00 CutScore  91.99;  Ed  0, 0
ans =

    ' IL_50715.3  4WF9 C 1168 G 1074'

 matches the original group, cWW-tSH-tHH-L-R-L-R-L-tWW-L-cWW-L-L-L-R-L
Better:   0 Equal:   0 Score 1.00 GGAAGAUGUAACGGGGC*GGGAAAC (   1) MLPS -17.83 deficit   2.95 prct   0.00 CutScore  88.20;  Ed  0, 0
ans =

    ' IL_50715.3  5J7L G 1124 C 1030'

 matches the original group, cWW-tSH-tHH-L-R-L-R-L-tWW-L-cWW-L-L-L-R-L
Group 125 is from IL_29826.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_29826.1
This group is considered to be structured ***************************
Number of NTs: 25  Signature: cWW-tSH-tHH-L-R-L-R-cSH-R-R-L-R-L-R-L-R-L-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CCAAAAUGAUCGGGA*UAAUCCUCUGAAG (   1) MLPS -18.04 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_29826.1  4V9F C 1228 G 1134'

 matches the original group, cWW-tSH-tHH-L-R-L-R-cSH-R-R-L-R-L-R-L-R-L-R-L-cWW
Group  37 is from IL_09044.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09044.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-tHH-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UGACAAC*GGAAG (   1) MLPS  -6.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09044.1  9DFE U 1540 G 1529'

 matches the original group, cWW-tSH-tHH-L-tHS-cWW
Group 173 is from IL_43547.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_43547.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-tSH-tHH-cSH-tWH-tHS-R-L-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  CCAGUAGAAC*GAAGAACG (   1) MLPS  -8.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_43547.1  6UFG C   53 G   41'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-R-L-cWW-L-cWW
Better:   0 Equal:   0 Score 1.00  CCAGUAGAAC*GAAGAACG (   1) MLPS  -8.23 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_43547.1  6UFH C   54 G   41'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-R-L-cWW-L-cWW
Better:   0 Equal:   0 Score 1.00  UCAGUAGAAC*GAAGAACG (   1) MLPS  -8.45 deficit   0.23 prct   0.00 CutScore  98.96;  Ed  0, 0
ans =

    ' IL_43547.1  6UFM U   64 G   41'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-R-L-cWW-L-cWW
Group 109 is from IL_26307.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_26307.2
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tSH-tHH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GUAGUAG*CGAAAC (   1) MLPS  -7.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26307.2  8CRE G 1440 C 2337'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       GUAGUAG*CGAAAC (   1) MLPS  -7.69 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_26307.2  8P9A G 1444 C 2359'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   1 Equal:   0 Score 0.00       AUAGUAC*GGAACU (   1) MLPS  -7.71 deficit   0.02 prct   0.00 CutScore  99.91;  Ed  0, 0
ans =

    ' IL_26307.2  4V9F A 2689 U 2705'

 scores better against   1 groups: IL_16458.4, 13 NTs, cWW-L-R-L-R-cSH-tWH-tHS-cWW             , Ed  3, 1, MLPS -7.22, deficit  2.65, prct   0.00; 
Better:   0 Equal:   0 Score 1.00       CCAGUAG*CGAACG (   1) MLPS  -7.87 deficit   0.18 prct   0.00 CutScore  99.04;  Ed  0, 0
ans =

    ' IL_26307.2  5J7L C  239 G  258'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UGAGUAG*CGAAAG (   1) MLPS  -8.01 deficit   0.32 prct   0.00 CutScore  98.28;  Ed  0, 0
ans =

    ' IL_26307.2  9DFE U  239 G  258'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UUAGUAA*UGAACG (   1) MLPS  -8.15 deficit   0.46 prct   0.00 CutScore  97.57;  Ed  0, 0
ans =

    ' IL_26307.2  4V9F U  210 G  229'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       GGAGUAC*GGAAAU (   1) MLPS  -8.57 deficit   0.88 prct   0.00 CutScore  95.32;  Ed  0, 0
ans =

    ' IL_26307.2  4V9F G   75 U  106'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       AUAGUAG*UGAACU (   1) MLPS  -8.75 deficit   1.07 prct   0.00 CutScore  94.35;  Ed  0, 0
ans =

    ' IL_26307.2  4V9F A 1367 U 2057'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UGAGUAU*AAAAAA (   1) MLPS  -9.20 deficit   1.52 prct   0.00 CutScore  91.96;  Ed  0, 0
ans =

    ' IL_26307.2  1NBS U  165 A  143'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW
Group 161 is from IL_41756.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_41756.4
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-tSH-tHH-cSH-tWH-tHS-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GGAGUAUG*UGAAAC (   1) MLPS  -6.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_41756.4  8P9A G 1111 C 1134'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW-L
Better:   0 Equal:   0 Score 1.00      GGAGUAUG*UGAAAC (   1) MLPS  -6.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_41756.4  8CRE G 1096 C 1119'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW-L
Better:   0 Equal:   0 Score 1.00      GGAGUACG*UGAAAC (   1) MLPS  -6.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_41756.4  4LFB G  887 C  910'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW-L
Better:   0 Equal:   0 Score 1.00      GGAGUACG*UAAAAC (   1) MLPS  -7.48 deficit   0.59 prct   0.00 CutScore  97.05;  Ed  0, 0
ans =

    ' IL_41756.4  5J7L G  887 C  910'

 matches the original group, cWW-tSH-tHH-cSH-tWH-tHS-cWW-L
Group  70 is from IL_17069.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_17069.5
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tSH-tHH-cSS-tWW-tHH-tSS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00    GGACGUAUA*UGCAAAC (   1) MLPS  -7.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_17069.5  5J7L G 1813 C 1804'

 matches the original group, cWW-tSH-tHH-cSS-tWW-tHH-tSS-cWW
Better:   0 Equal:   0 Score 1.00    GGACGUAUA*UGCCAAC (   1) MLPS  -8.30 deficit   0.51 prct   0.00 CutScore  97.76;  Ed  0, 0
ans =

    ' IL_17069.5  7A0S G 1805 C 1795'

 matches the original group, cWW-tSH-tHH-cSS-tWW-tHH-tSS-cWW
Better:   0 Equal:   0 Score 1.00    GGAGGUAUA*UGCGAAC (   1) MLPS  -9.15 deficit   1.36 prct   0.00 CutScore  94.04;  Ed  0, 0
ans =

    ' IL_17069.5  9DFE G 1813 C 1804'

 matches the original group, cWW-tSH-tHH-cSS-tWW-tHH-tSS-cWW
Better:   0 Equal:   0 Score 1.00    UGAUGUAUA*UGCUAAA (   1) MLPS  -9.26 deficit   1.47 prct   0.00 CutScore  93.56;  Ed  0, 0
ans =

    ' IL_17069.5  4WF9 U 1840 A 1831'

 matches the original group, cWW-tSH-tHH-cSS-tWW-tHH-tSS-cWW
Better:   0 Equal:   0 Score 1.00    ACUCGUACG*CGCAAAU (   1) MLPS -12.70 deficit   4.91 prct   0.00 CutScore  78.45;  Ed  0, 0
ans =

    ' IL_17069.5  4V9F A 1869 U 1860'

 matches the original group, cWW-tSH-tHH-cSS-tWW-tHH-tSS-cWW
Group 254 is from IL_62654.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_62654.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CGAAC*GCAUAG (   1) MLPS  -8.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_62654.1  4V9F C 1570 G 1627'

 matches the original group, cWW-tSH-tHH-tHS-cWW
Group 223 is from IL_55953.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_55953.3
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tHS-R-L-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        GGACCC*GCUAAC (   1) MLPS  -4.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_55953.3  4QK9 G   29 C  103'

 matches the original group, cWW-tSH-tHS-R-L-L-R-cWW
Better:   0 Equal:   0 Score 1.00        GGACCC*GCUAAC (   1) MLPS  -4.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_55953.3  4W90 G   28 C  106'

 matches the original group, cWW-tSH-tHS-R-L-L-R-cWW
Better:   0 Equal:   0 Score 1.00        GGACCC*GCUAAC (   1) MLPS  -4.44 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_55953.3  4QLM G   27 C  101'

 matches the original group, cWW-tSH-tHS-R-L-L-R-cWW
Better:   0 Equal:   0 Score 1.00        GGAACC*GCUAAC (   1) MLPS  -5.29 deficit   0.85 prct   0.00 CutScore  95.76;  Ed  0, 0
ans =

    ' IL_55953.3  6N5P G   31 C  104'

 matches the original group, cWW-tSH-tHS-R-L-L-R-cWW
Group  40 is from IL_09705.15 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_09705.15
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09705.15  5J7L C 2350 G 2367'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09705.15  4WF9 C 2377 G 2394'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09705.15  9DFE C 2350 G 2367'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09705.15  7A0S C 2329 G 2346'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09705.15  1SA9 C  211 G  206'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09705.15  3D0U C   67 G   19'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09705.15  1SAQ C  203 G  214'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09705.15  4V9F C 2873 G 2884'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAG*CGAG (   1) MLPS  -5.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_09705.15  3DIL C   70 G   22'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            AGAG*CGAU (   1) MLPS  -5.52 deficit   0.44 prct   0.00 CutScore  95.35;  Ed  0, 0
ans =

    ' IL_09705.15  8CRE A 3307 U 3328'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            AGAG*CGAU (   1) MLPS  -5.52 deficit   0.44 prct   0.00 CutScore  95.35;  Ed  0, 0
ans =

    ' IL_09705.15  8P9A A 3342 U 3363'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAU*AGAG (   1) MLPS  -5.54 deficit   0.46 prct   0.00 CutScore  95.13;  Ed  0, 0
ans =

    ' IL_09705.15  8CRE C 1640 G 1734'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAU*AGAG (   1) MLPS  -5.54 deficit   0.46 prct   0.00 CutScore  95.13;  Ed  0, 0
ans =

    ' IL_09705.15  8P9A C 1653 G 1747'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            AGAC*GGAU (   1) MLPS  -5.57 deficit   0.50 prct   0.00 CutScore  94.74;  Ed  0, 0
ans =

    ' IL_09705.15  5AOX A  105 U   61'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            GGAC*GGAC (   1) MLPS  -5.66 deficit   0.59 prct   0.00 CutScore  93.84;  Ed  0, 0
ans =

    ' IL_09705.15  4ZNP G    9 C   40'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAC*GAAG (   1) MLPS  -5.72 deficit   0.64 prct   0.00 CutScore  93.24;  Ed  0, 0
ans =

    ' IL_09705.15  8CRE C  184 G  197'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CGAC*GAAG (   1) MLPS  -5.72 deficit   0.64 prct   0.00 CutScore  93.24;  Ed  0, 0
ans =

    ' IL_09705.15  8P9A C  186 G  199'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UGAC*GGAG (   1) MLPS  -6.02 deficit   0.95 prct   0.00 CutScore  90.03;  Ed  0, 0
ans =

    ' IL_09705.15  4XWF U    7 G   39'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UGAC*GGAG (   1) MLPS  -6.02 deficit   0.95 prct   0.00 CutScore  90.03;  Ed  0, 0
ans =

    ' IL_09705.15  4LFB U 1481 G 1419'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UGAC*GGAG (   1) MLPS  -6.02 deficit   0.95 prct   0.00 CutScore  90.03;  Ed  0, 0
ans =

    ' IL_09705.15  5J7L U  554 G  539'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UGAG*CAAA (   1) MLPS  -6.15 deficit   1.08 prct   0.00 CutScore  88.68;  Ed  0, 0
ans =

    ' IL_09705.15  8CRE U 1656 A 1719'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UGAG*CAAA (   1) MLPS  -6.15 deficit   1.08 prct   0.00 CutScore  88.68;  Ed  0, 0
ans =

    ' IL_09705.15  8P9A U 1669 A 1732'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CAAC*GGCG (   1) MLPS  -6.27 deficit   1.20 prct   0.00 CutScore  87.37;  Ed  0, 0
ans =

    ' IL_09705.15  6YL5 C   12 G   27'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CAAC*GGCG (   1) MLPS  -6.27 deficit   1.20 prct   0.00 CutScore  87.37;  Ed  0, 0
ans =

    ' IL_09705.15  6YML C   12 G   27'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CCAC*GGCG (   1) MLPS  -6.29 deficit   1.21 prct   0.00 CutScore  87.22;  Ed  0, 0
ans =

    ' IL_09705.15  4UYK C  121 G   80'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            CCAC*GGAG (   1) MLPS  -6.36 deficit   1.29 prct   0.00 CutScore  86.44;  Ed  0, 0
ans =

    ' IL_09705.15  4LFB C 1259 G 1276'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UGAU*AGAG (   1) MLPS  -6.42 deficit   1.35 prct   0.00 CutScore  85.77;  Ed  0, 0
ans =

    ' IL_09705.15  4WF9 U  597 G  584'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UGAC*GAAG (   1) MLPS  -6.61 deficit   1.53 prct   0.00 CutScore  83.87;  Ed  0, 0
ans =

    ' IL_09705.15  5BTP U   12 G   44'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            UGAC*GAAG (   1) MLPS  -6.61 deficit   1.53 prct   0.00 CutScore  83.87;  Ed  0, 0
ans =

    ' IL_09705.15  9BZC U    9 G   39'

 matches the original group, cWW-tSH-tHS-cWW
Better:   0 Equal:   0 Score 1.00            GAAG*CGAC (   1) MLPS  -6.76 deficit   1.69 prct   0.00 CutScore  82.25;  Ed  0, 0
ans =

    ' IL_09705.15  8T29 G   80 C   11'

 matches the original group, cWW-tSH-tHS-cWW
Better:   3 Equal:   0 Score 0.00            UAAC*GAAA (   1) MLPS  -7.36 deficit   2.29 prct   0.00 CutScore  75.88;  Ed  0, 0
ans =

    ' IL_09705.15  4KZD U   71 A   14'

 scores better against   3 groups: IL_80398.1,  8 NTs, cWW-L-cSW-L-R-cWW                       , Ed  0, 0, MLPS -5.27, deficit  0.00, prct   0.00; IL_04785.1,  8 NTs, cWW-L-R-L-R-cWW                         , Ed  5, 3, MLPS -6.25, deficit -0.48, prct   0.00; IL_96759.1,  8 NTs, cWW-tSH-tWW-cWW                         , Ed  4, 2, MLPS -6.31, deficit  1.43, prct   0.00; 
Better:   0 Equal:   0 Score 1.00            GGAG*UGAC (   1) MLPS  -7.70 deficit   2.63 prct   0.00 CutScore  72.31;  Ed  0, 0
ans =

    ' IL_09705.15  5J7L G 1416 C 1484'

 matches the original group, cWW-tSH-tHS-cWW
Better:   4 Equal:   0 Score 0.00          AGAACG*CAAU (   1) MLPS -10.62 deficit   5.55 prct   0.00 CutScore  41.58;  Ed  0, 0
ans =

    ' IL_09705.15  8P9A A 3139 U 3007'

 scores better against   4 groups: IL_11344.2,  5 NTs, cWW-cSS-L-cWW                           , Ed  5, 1, MLPS -8.67, deficit  0.26, prct   0.00; IL_05192.4, 10 NTs, cWW-L-R-L-R-L-cWW-L                     , Ed  2, 0, MLPS -9.15, deficit  0.10, prct   0.00; IL_90346.1,  9 NTs, cWW-L-R-L-cWW-L-L                       , Ed  6, 2, MLPS -9.28, deficit  2.37, prct   0.00; IL_07469.2, 10 NTs, cWW-tSH-cWW-cSH-R-cWW                   , Ed  4, 3, MLPS -9.80, deficit  6.27, prct   0.00; 
Better:   4 Equal:   0 Score 0.00          AGAACG*CAAU (   1) MLPS -10.62 deficit   5.55 prct   0.00 CutScore  41.58;  Ed  0, 0
ans =

    ' IL_09705.15  8CRE A 3111 U 2979'

 scores better against   4 groups: IL_11344.2,  5 NTs, cWW-cSS-L-cWW                           , Ed  5, 1, MLPS -8.67, deficit  0.26, prct   0.00; IL_05192.4, 10 NTs, cWW-L-R-L-R-L-cWW-L                     , Ed  2, 0, MLPS -9.15, deficit  0.10, prct   0.00; IL_90346.1,  9 NTs, cWW-L-R-L-cWW-L-L                       , Ed  6, 2, MLPS -9.28, deficit  2.37, prct   0.00; IL_07469.2, 10 NTs, cWW-tSH-cWW-cSH-R-cWW                   , Ed  4, 3, MLPS -9.80, deficit  6.27, prct   0.00; 
Group  45 is from IL_10484.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_10484.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00            UUCG*UUCG (   1) MLPS  -5.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_10484.1  6E7L U   10 G   13'

 scores better against   1 groups: IL_13404.2,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  0, 0, MLPS -4.22, deficit  0.00, prct   0.00; 
Better:   0 Equal:   0 Score 1.00           UGAG*UAAAG (   1) MLPS  -6.42 deficit   0.49 prct   0.00 CutScore  95.78;  Ed  0, 0
ans =

    ' IL_10484.1  3PDR U   28 G  157'

 matches the original group, cWW-tSH-tHS-cWW
Group 205 is from IL_50730.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_50730.2
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-tHS-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGAAG*UGGAG (   1) MLPS  -6.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_50730.2  4WF9 U  748 G  773'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAAG*UGGAG (   1) MLPS  -6.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_50730.2  9DFE U  703 G  728'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAAG*UGGAG (   1) MLPS  -6.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_50730.2  8CRE U  830 G  855'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAAG*UGGAG (   1) MLPS  -6.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_50730.2  5J7L U  703 G  728'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAAG*UGGAG (   1) MLPS  -6.37 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_50730.2  8P9A U  834 G  859'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGAAC*GGGAG (   1) MLPS  -6.44 deficit   0.06 prct   0.00 CutScore  99.40;  Ed  0, 0
ans =

    ' IL_50730.2  9DFE C 1882 G 1860'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAAG*UGGAA (   1) MLPS  -6.49 deficit   0.11 prct   0.00 CutScore  98.92;  Ed  0, 0
ans =

    ' IL_50730.2  4V9F U  794 A  819'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGAAG*CGGAG (   1) MLPS  -6.54 deficit   0.17 prct   0.00 CutScore  98.43;  Ed  0, 0
ans =

    ' IL_50730.2  2A64 C  378 G  351'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGAAG*CGGAG (   1) MLPS  -6.54 deficit   0.17 prct   0.00 CutScore  98.43;  Ed  0, 0
ans =

    ' IL_50730.2  2A64 C  284 G  301'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGAAA*UGGAG (   1) MLPS  -6.57 deficit   0.20 prct   0.00 CutScore  98.12;  Ed  0, 0
ans =

    ' IL_50730.2  7A0S C 1865 G 1852'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAAU*AGGAA (   1) MLPS  -6.68 deficit   0.30 prct   0.00 CutScore  97.14;  Ed  0, 0
ans =

    ' IL_50730.2  8CRE U 1641 A 1806'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAAU*AGGAA (   1) MLPS  -6.68 deficit   0.30 prct   0.00 CutScore  97.14;  Ed  0, 0
ans =

    ' IL_50730.2  8P9A U 1645 A 1810'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          AGAAG*CGGAU (   1) MLPS  -6.83 deficit   0.46 prct   0.00 CutScore  95.68;  Ed  0, 0
ans =

    ' IL_50730.2  8CRE A 1706 U 1669'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          AGAAU*AGGAU (   1) MLPS  -6.85 deficit   0.47 prct   0.00 CutScore  95.55;  Ed  0, 0
ans =

    ' IL_50730.2  8P9A A 1719 U 1682'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UAAAC*GGGCG (   1) MLPS  -7.36 deficit   0.99 prct   0.00 CutScore  90.66;  Ed  0, 0
ans =

    ' IL_50730.2  4YAZ U   16 G   39'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAGG*UGGAG (   1) MLPS  -8.70 deficit   2.32 prct   0.00 CutScore  78.07;  Ed  0, 0
ans =

    ' IL_50730.2  5J7L U 1720 G 1740'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CAAAC*GGACG (   1) MLPS  -8.71 deficit   2.33 prct   0.00 CutScore  77.97;  Ed  0, 0
ans =

    ' IL_50730.2  3IWN C   12 G   35'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CAAAC*GGACG (   1) MLPS  -8.71 deficit   2.33 prct   0.00 CutScore  77.97;  Ed  0, 0
ans =

    ' IL_50730.2  3MXH C   22 G   45'

 matches the original group, cWW-tSH-tHS-tHS-cWW
Better:   3 Equal:   0 Score 0.00          CUAAC*GGACG (   1) MLPS  -9.31 deficit   2.94 prct   0.00 CutScore  72.25;  Ed  0, 0
ans =

    ' IL_50730.2  3IGI C   70 G  117'

 scores better against   3 groups: IL_89021.2, 10 NTs, cWW-L-R-L-R-tHS-cWW                     , Ed  3, 1, MLPS -6.66, deficit  0.65, prct   0.00; IL_38507.2,  9 NTs, cWW-tWH-L-tHS-cWW                       , Ed  3, 1, MLPS -8.70, deficit  3.61, prct   0.00; IL_16218.2,  9 NTs, cWW-L-R-L-R-L-cWW                       , Ed  6, 4, MLPS -8.86, deficit  2.52, prct   0.00; 
Group 251 is from IL_61440.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_61440.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-tHS-tWS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00          CGAAG*UGGAG (   1) MLPS  -6.97 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_61440.1  4UYK C   86 G  115'

 scores better against   1 groups: IL_50730.2, 10 NTs, cWW-tSH-tHS-tHS-cWW                     , Ed  1, 0, MLPS -6.37, deficit -0.01, prct   0.00; 
Group 225 is from IL_56455.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_56455.6
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-tSH-tHW-L-R-L-R-L-R-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  CGAGAGUAG*CGAUGGUAG (   1) MLPS  -9.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_56455.6  1DFU C   97 G   79'

 matches the original group, cWW-tSH-tHW-L-R-L-R-L-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  CGAGAGUAG*CGAUGGUAG (   1) MLPS  -9.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_56455.6  354D C   97 G   79'

 matches the original group, cWW-tSH-tHW-L-R-L-R-L-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  CGAGAGUAG*CGAUGGUAG (   1) MLPS  -9.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_56455.6  5J7L C   97 G   79'

 matches the original group, cWW-tSH-tHW-L-R-L-R-L-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  CGAGAGUAG*CGAUGGUAG (   1) MLPS  -9.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_56455.6  1FEU C   97 G   79'

 matches the original group, cWW-tSH-tHW-L-R-L-R-L-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  CGAGAGUAG*CGAUGGUAG (   1) MLPS  -9.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_56455.6  364D C   97 G   79'

 matches the original group, cWW-tSH-tHW-L-R-L-R-L-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  GGAGAGUAG*CGAUGGUAC (   1) MLPS  -9.78 deficit   0.13 prct   0.00 CutScore  99.43;  Ed  0, 0
ans =

    ' IL_56455.6  9DFE G   98 C   79'

 matches the original group, cWW-tSH-tHW-L-R-L-R-L-R-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00  GAAAAGUCG*CAAUGAUAC (   1) MLPS -10.71 deficit   1.06 prct   0.00 CutScore  95.46;  Ed  0, 0
ans =

    ' IL_56455.6  7A0S G  100 C   81'

 matches the original group, cWW-tSH-tHW-L-R-L-R-L-R-tWH-tHS-cWW
Group  90 is from IL_21200.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_21200.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-tHW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CAAGAG*CUAG (   1) MLPS  -6.32 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_21200.1  5T83 C   42 G   15'

 matches the original group, cWW-tSH-tHW-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CGAGAG*CUAG (   1) MLPS  -6.34 deficit   0.02 prct   0.00 CutScore  99.87;  Ed  0, 0
ans =

    ' IL_21200.1  7MLW C   51 G   10'

 matches the original group, cWW-tSH-tHW-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CGAGAG*CUAG (   1) MLPS  -6.34 deficit   0.02 prct   0.00 CutScore  99.87;  Ed  0, 0
ans =

    ' IL_21200.1  5U3G C   30 G    9'

 matches the original group, cWW-tSH-tHW-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CAAGCG*CUAG (   1) MLPS  -6.66 deficit   0.34 prct   0.00 CutScore  97.76;  Ed  0, 0
ans =

    ' IL_21200.1  6DME C   40 G   14'

 matches the original group, cWW-tSH-tHW-L-cWW-L
Better:   0 Equal:   0 Score 1.00          CGAGCG*CUAG (   1) MLPS  -6.68 deficit   0.36 prct   0.00 CutScore  97.62;  Ed  0, 0
ans =

    ' IL_21200.1  6CK5 C   45 G   15'

 matches the original group, cWW-tSH-tHW-L-cWW-L
Better:   1 Equal:   0 Score 0.00          CAAGUG*CUAG (   1) MLPS  -7.17 deficit   0.85 prct   0.00 CutScore  94.35;  Ed  0, 0
ans =

    ' IL_21200.1  6DLR C   45 G   15'

 scores better against   1 groups: IL_82683.2,  8 NTs, cWW-L-R-L-cWW-L                         , Ed  3, 1, MLPS -6.87, deficit  3.61, prct   0.00; 
Group 181 is from IL_44874.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_44874.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-tHW-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CGAACCC*GUAG (   1) MLPS  -6.48 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_44874.1  3NDB C  192 G  226'

 matches the original group, cWW-tSH-tHW-L-cWW-L-L
Group  87 is from IL_20463.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_20463.1
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-tSH-tHW-cSH-tHH-cWH-L-R-cWW-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  UGAAGCAACGC*GAAGUAA (   1) MLPS  -9.87 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_20463.1  5DDP U   50 A   29'

 matches the original group, cWW-tSH-tHW-cSH-tHH-cWH-L-R-cWW-L-L-R
Group  20 is from IL_04638.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_04638.3
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tSH-tHW-tHS-cSH-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CAAGAUGAG*UUGAG (   1) MLPS  -8.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04638.3  9DFE C 2774 G 2640'

 matches the original group, cWW-tSH-tHW-tHS-cSH-cWW-L
Better:   0 Equal:   0 Score 1.00      CAAGAUGAG*UUGAG (   1) MLPS  -8.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04638.3  7A0S C 2754 G 2619'

 matches the original group, cWW-tSH-tHW-tHS-cSH-cWW-L
Better:   0 Equal:   0 Score 1.00      CAAGAUGAG*UUGAG (   1) MLPS  -8.90 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_04638.3  4WF9 C 2801 G 2667'

 matches the original group, cWW-tSH-tHW-tHS-cSH-cWW-L
Better:   0 Equal:   0 Score 1.00      CGAGAUGAG*CUGAG (   1) MLPS  -9.61 deficit   0.71 prct   0.00 CutScore  96.43;  Ed  0, 0
ans =

    ' IL_04638.3  5J7L C 2774 G 2640'

 matches the original group, cWW-tSH-tHW-tHS-cSH-cWW-L
Better:   0 Equal:   0 Score 1.00      GGAAAAGAG*CUGAC (   1) MLPS  -9.95 deficit   1.05 prct   0.00 CutScore  94.73;  Ed  0, 0
ans =

    ' IL_04638.3  4V9F G 2809 C 2676'

 matches the original group, cWW-tSH-tHW-tHS-cSH-cWW-L
Group  71 is from IL_17136.7 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_17136.7
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSH-tHW-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          UGAGG*CGUAG (   1) MLPS  -6.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_17136.7  4WF9 U 1394 G 1411'

 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAAG*CGUAG (   1) MLPS  -6.26 deficit   0.24 prct   0.00 CutScore  97.85;  Ed  0, 0
ans =

    ' IL_17136.7  9DFE U 1357 G 1374'

 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGAGG*CGUAG (   1) MLPS  -6.50 deficit   0.48 prct   0.00 CutScore  95.78;  Ed  0, 0
ans =

    ' IL_17136.7  5J7L C 1357 G 1374'

 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   1 Equal:   0 Score 0.00          CGAAG*CGUAG (   1) MLPS  -6.74 deficit   0.72 prct   0.00 CutScore  93.63;  Ed  0, 0
ans =

    ' IL_17136.7  8CRE C  975 G  999'

 scores better against   1 groups: IL_38862.4, 10 NTs, cWW-cSH-R-tWH-tHS-cWW                   , Ed  1, 0, MLPS -6.74, deficit  0.70, prct   0.00; 
Better:   1 Equal:   0 Score 0.00          CGAAG*CGUAG (   1) MLPS  -6.74 deficit   0.72 prct   0.00 CutScore  93.63;  Ed  0, 0
ans =

    ' IL_17136.7  8P9A C  990 G 1014'

 scores better against   1 groups: IL_38862.4, 10 NTs, cWW-cSH-R-tWH-tHS-cWW                   , Ed  1, 0, MLPS -6.74, deficit  0.70, prct   0.00; 
Better:   0 Equal:   0 Score 1.00          UCAAG*CGUAG (   1) MLPS  -6.77 deficit   0.75 prct   0.00 CutScore  93.36;  Ed  0, 0
ans =

    ' IL_17136.7  8CRE U  953 G  629'

 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAAG*CGUAG (   1) MLPS  -6.77 deficit   0.75 prct   0.00 CutScore  93.36;  Ed  0, 0
ans =

    ' IL_17136.7  8P9A U  968 G  631'

 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UGAGG*CGCAG (   1) MLPS  -7.14 deficit   1.12 prct   0.00 CutScore  90.12;  Ed  0, 0
ans =

    ' IL_17136.7  7A0S U 1370 G 1387'

 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAAC*GGUCG (   1) MLPS  -7.33 deficit   1.31 prct   0.00 CutScore  88.44;  Ed  0, 0
ans =

    ' IL_17136.7  4V9F U 1639 G 1546'

 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CGAGG*CGCAG (   1) MLPS  -7.62 deficit   1.60 prct   0.00 CutScore  85.90;  Ed  0, 0
ans =

    ' IL_17136.7  4V9F C  719 G  709'

 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UCAGG*CGCAG (   1) MLPS  -7.65 deficit   1.63 prct   0.00 CutScore  85.63;  Ed  0, 0
ans =

    ' IL_17136.7  5J7L U  757 G  584'

 matches the original group, cWW-tSH-tHW-tHS-cWW
Better:   1 Equal:   0 Score 0.00          UGAGG*UGUAG (   1) MLPS  -7.66 deficit   1.64 prct   0.00 CutScore  85.58;  Ed  0, 0
ans =

    ' IL_17136.7  4LFB U  757 G  584'

 scores better against   1 groups: IL_38862.4, 10 NTs, cWW-cSH-R-tWH-tHS-cWW                   , Ed  0, 0, MLPS -7.01, deficit  0.97, prct   0.00; 
Better:   1 Equal:   0 Score 0.00          CAAAC*GGUAG (   1) MLPS  -7.80 deficit   1.79 prct   0.00 CutScore  84.28;  Ed  0, 0
ans =

    ' IL_17136.7  5J7L C  779 G  803'

 scores better against   1 groups: IL_38862.4, 10 NTs, cWW-cSH-R-tWH-tHS-cWW                   , Ed  0, 0, MLPS -6.83, deficit  0.80, prct   0.00; 
Better:   1 Equal:   0 Score 0.00          CAAAC*GGUAG (   1) MLPS  -7.80 deficit   1.79 prct   0.00 CutScore  84.28;  Ed  0, 0
ans =

    ' IL_17136.7  4LFB C  779 G  803'

 scores better against   1 groups: IL_38862.4, 10 NTs, cWW-cSH-R-tWH-tHS-cWW                   , Ed  0, 0, MLPS -6.83, deficit  0.80, prct   0.00; 
Group 311 is from IL_76308.6 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_76308.6
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tHW-tHS-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UCAGGU*AAGCAG (   1) MLPS  -7.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_76308.6  1LNT U    4 G   21'

 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   0 Equal:   0 Score 1.00        UCAGGU*AAGCAG (   1) MLPS  -7.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_76308.6  3LQX U  146 G  165'

 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   1 Equal:   0 Score 0.00        CCAGGU*GAGCAG (   1) MLPS  -8.10 deficit   0.66 prct   0.00 CutScore  96.32;  Ed  0, 0
ans =

    ' IL_76308.6  1MFQ C  190 G  209'

 scores better against   1 groups: IL_71294.3, 12 NTs, cWW-L-R-L-R-L-R-L-R-cWW                 , Ed  0, 0, MLPS -7.93, deficit  0.00, prct   0.00; 
Better:   0 Equal:   0 Score 1.00        CUACCC*GAACAG (   1) MLPS -12.05 deficit   4.60 prct   0.00 CutScore  74.19;  Ed  0, 0
ans =

    ' IL_76308.6  6DVK C   52 G   43'

 matches the original group, cWW-tSH-tHW-tHS-cWW-cWW
Better:   2 Equal:   0 Score 0.00        GGCCAG*CUCAAC (   1) MLPS -14.94 deficit   7.49 prct   0.00 CutScore  57.98;  Ed  0, 0
ans =

    ' IL_76308.6  8ZA4 G    5 C   12'

 scores better against   2 groups: IL_06136.2, 12 NTs, cWW-tHS-cWW-tHS-tSH-tSH-cWW             , Ed  6, 4, MLPS -11.21, deficit  1.65, prct   0.00; IL_82292.1, 12 NTs, cWW-L-R-L-R-L-R-L-R-cWW                 , Ed  4, 2, MLPS -14.13, deficit  3.93, prct   0.00; 
Group 364 is from IL_87284.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_87284.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tHW-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UCACAG*UCACAG (   1) MLPS  -9.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87284.1  1KD4 U    3 G    8'

 matches the original group, cWW-tSH-tHW-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00        UCACAG*UCACAG (   1) MLPS  -9.07 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_87284.1  1KD5 U    3 G    8'

 matches the original group, cWW-tSH-tHW-tWH-tHS-cWW
Better:   2 Equal:   0 Score 0.00        CGAAAG*CGAAAG (   1) MLPS -12.16 deficit   3.08 prct   0.00 CutScore  80.68;  Ed  0, 0
ans =

    ' IL_87284.1  283D C    4 G    9'

 scores better against   2 groups: IL_49767.8, 11 NTs, cWW-cWW-tWH-L-tHS-cWW                   , Ed  3, 1, MLPS -10.38, deficit  3.63, prct   0.00; IL_06136.2, 12 NTs, cWW-tHS-cWW-tHS-tSH-tSH-cWW             , Ed  4, 2, MLPS -11.10, deficit  1.55, prct   0.00; 
Group 136 is from IL_32016.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_32016.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSH-tSH-tSS-tHS-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UGGAAG*CAGGAAG (   1) MLPS  -6.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_32016.1  4V9F U 1587 G 1608'

 matches the original group, cWW-tSH-tSH-tSS-tHS-L-R-cWW
Group  85 is from IL_20047.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_20047.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSH-tWH-cSH-cHW-cWH-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      UGUUGACG*CGAUGG (   1) MLPS  -6.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_20047.1  8P9A U 2173 G 2161'

 matches the original group, cWW-tSH-tWH-cSH-cHW-cWH-cWW-cWW
Better:   0 Equal:   0 Score 1.00      UGUUGACA*UGAUGG (   1) MLPS  -6.57 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_20047.1  8CRE U 2151 G 2139'

 matches the original group, cWW-tSH-tWH-cSH-cHW-cWH-cWW-cWW
Group  10 is from IL_02349.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_02349.4
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tSH-tWH-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GGGAGUAG*CGAGAC (   1) MLPS  -6.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_02349.4  4Y1M G    8 C  101'

 matches the original group, cWW-tSH-tWH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00      GGGAGUAG*CGAGAC (   1) MLPS  -6.10 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_02349.4  6N2V G    7 C   93'

 matches the original group, cWW-tSH-tWH-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00      GGGAGUAG*CAAGAC (   1) MLPS  -6.36 deficit   0.26 prct   0.00 CutScore  98.71;  Ed  0, 0
ans =

    ' IL_02349.4  6CB3 G    7 C   96'

 matches the original group, cWW-tSH-tWH-cSH-tWH-tHS-cWW
Group 115 is from IL_28026.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_28026.3
This group is considered to be structured ***************************
Number of NTs: 15  Signature: cWW-tSH-tWH-cWH-L-tHW-tSS-tHH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     UGAAGAAG*UGUAAAG (   1) MLPS  -6.54 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_28026.3  5J7L U  409 G  433'

 matches the original group, cWW-tSH-tWH-cWH-L-tHW-tSS-tHH-cWW
Better:   0 Equal:   0 Score 1.00     GGAAGAAG*UGUAAAC (   1) MLPS  -6.88 deficit   0.34 prct   0.00 CutScore  98.29;  Ed  0, 0
ans =

    ' IL_28026.3  4LFB G  409 C  433'

 matches the original group, cWW-tSH-tWH-cWH-L-tHW-tSS-tHH-cWW
Group 401 is from IL_96759.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_96759.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSH-tWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00            CGAA*UUAG (   1) MLPS  -4.89 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_96759.1  5V1K C  203 G  110'

 matches the original group, cWW-tSH-tWW-cWW
Group 100 is from IL_24134.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_24134.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSS-L-R-L-tHS-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CGAGAAAC*GGAG (   1) MLPS  -4.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_24134.1  2VPL C   33 G   13'

 matches the original group, cWW-tSS-L-R-L-tHS-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00        CGAGAAAC*GGAG (   1) MLPS  -4.28 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_24134.1  1U63 C   33 G   13'

 matches the original group, cWW-tSS-L-R-L-tHS-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00        CGCGAAAC*GGAG (   1) MLPS  -4.79 deficit   0.51 prct   0.00 CutScore  96.84;  Ed  0, 0
ans =

    ' IL_24134.1  2HW8 C   22 G   13'

 matches the original group, cWW-tSS-L-R-L-tHS-L-cWW-L-L
Group 309 is from IL_75283.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_75283.2
This group is considered to be structured ***************************
Number of NTs: 18  Signature: cWW-tSS-L-R-L-tHS-L-cWW-L-tWH-tWH-L-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  CGCCGGUGAAAUAC*GGAG (   1) MLPS  -6.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_75283.2  3U4M C 2161 G 2127'

 matches the original group, cWW-tSS-L-R-L-tHS-L-cWW-L-tWH-tWH-L-L-R
Better:   0 Equal:   0 Score 1.00  CGCCGGUGAAAUAC*GGAG (   1) MLPS  -6.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_75283.2  1MZP C   32 G   23'

 matches the original group, cWW-tSS-L-R-L-tHS-L-cWW-L-tWH-tWH-L-L-R
Better:   0 Equal:   0 Score 1.00  CAACAGUGAAAUAC*GGAG (   1) MLPS  -8.25 deficit   1.53 prct   0.00 CutScore  93.87;  Ed  0, 0
ans =

    ' IL_75283.2  5ML7 C 2206 G 2168'

 matches the original group, cWW-tSS-L-R-L-tHS-L-cWW-L-tWH-tWH-L-L-R
Group 349 is from IL_84409.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_84409.1
This group is considered to be structured ***************************
Number of NTs: 23  Signature: cWW-tSS-L-cWH-L-cSH-cHW-tWH-cSS-tWH-tSW-cWS-R-L-R-cSH-R-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 CACAGUGACGAAGU*AGUGGAACGCG (   1) MLPS -14.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_84409.1  1NBS C  184 G  226'

 matches the original group, cWW-tSS-L-cWH-L-cSH-cHW-tWH-cSS-tWH-tSW-cWS-R-L-R-cSH-R-cWW-L
Group 207 is from IL_51265.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_51265.3
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSS-tHS-tSH-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CAAUGAG*UGAG (   1) MLPS  -4.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51265.3  3SIV C   33 G   50'

 matches the original group, cWW-tSS-tHS-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00         CAAUGAG*UGAG (   1) MLPS  -4.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51265.3  3SIU C   33 G   50'

 matches the original group, cWW-tSS-tHS-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00         CAAUGAG*UGAG (   1) MLPS  -4.59 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_51265.3  3SIV C   33 G   50'

 matches the original group, cWW-tSS-tHS-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00         CAAUGAG*CGAG (   1) MLPS  -4.87 deficit   0.28 prct   0.00 CutScore  98.21;  Ed  0, 0
ans =

    ' IL_51265.3  2OZB C   28 G   45'

 matches the original group, cWW-tSS-tHS-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00         CAAUGAG*CGAG (   1) MLPS  -4.87 deficit   0.28 prct   0.00 CutScore  98.21;  Ed  0, 0
ans =

    ' IL_51265.3  1E7K C   28 G   45'

 matches the original group, cWW-tSS-tHS-tSH-cWW-L
Better:   0 Equal:   0 Score 1.00         CGAUGAG*CGAG (   1) MLPS  -5.70 deficit   1.10 prct   0.00 CutScore  93.00;  Ed  0, 0
ans =

    ' IL_51265.3  4LCK C    6 G   97'

 matches the original group, cWW-tSS-tHS-tSH-cWW-L
Group 391 is from IL_94910.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_94910.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSS-tSH-L-R-R-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       UGAUGACC*GCAAG (   1) MLPS  -7.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_94910.1  4AOB U   31 G   21'

 matches the original group, cWW-tSS-tSH-L-R-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00      UGUUUGACG*CCGAG (   1) MLPS  -7.22 deficit   0.06 prct   0.00 CutScore  99.68;  Ed  0, 0
ans =

    ' IL_94910.1  4V9F U 1026 G  940'

 matches the original group, cWW-tSS-tSH-L-R-R-L-cWW-L
Better:   0 Equal:   0 Score 1.00       CUUUGACU*ACGAG (   1) MLPS  -9.35 deficit   2.20 prct   0.00 CutScore  89.02;  Ed  0, 0
ans =

    ' IL_94910.1  7A0S C   96 G   84'

 matches the original group, cWW-tSS-tSH-L-R-R-L-cWW-L
Group 411 is from IL_99692.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_99692.2
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tSS-tSH-L-R-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CCUAGACAG*CCGAG (   1) MLPS  -7.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_99692.2  4V9F C 1147 G 1216'

 matches the original group, cWW-tSS-tSH-L-R-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00      UCUAGACAG*CCGAA (   1) MLPS  -7.88 deficit   0.07 prct   0.00 CutScore  99.64;  Ed  0, 0
ans =

    ' IL_99692.2  8CRE U 1214 A 1283'

 matches the original group, cWW-tSS-tSH-L-R-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00      UCUAGACAG*CCGAA (   1) MLPS  -7.88 deficit   0.07 prct   0.00 CutScore  99.64;  Ed  0, 0
ans =

    ' IL_99692.2  8P9A U 1218 A 1287'

 matches the original group, cWW-tSS-tSH-L-R-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00      CGAAGACAG*UCGAG (   1) MLPS  -7.97 deficit   0.16 prct   0.00 CutScore  99.19;  Ed  0, 0
ans =

    ' IL_99692.2  9DFE C 1043 G 1112'

 matches the original group, cWW-tSS-tSH-L-R-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00      CUAAGACAG*UCGAG (   1) MLPS  -8.22 deficit   0.41 prct   0.00 CutScore  97.97;  Ed  0, 0
ans =

    ' IL_99692.2  5D8H C 1153 G 1222'

 matches the original group, cWW-tSS-tSH-L-R-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00      CCCAGACAG*UCGAG (   1) MLPS  -8.38 deficit   0.57 prct   0.00 CutScore  97.17;  Ed  0, 0
ans =

    ' IL_99692.2  5J7L C 1043 G 1112'

 matches the original group, cWW-tSS-tSH-L-R-R-L-cWW-L-L
Group   7 is from IL_01488.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_01488.3
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSS-tSH-L-R-tHS-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CGACGAUC*GGGAG (   1) MLPS  -6.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_01488.3  6UFM C    3 G   27'

 matches the original group, cWW-tSS-tSH-L-R-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00       CGUGGAUC*GGGAG (   1) MLPS  -6.52 deficit   0.14 prct   0.00 CutScore  99.26;  Ed  0, 0
ans =

    ' IL_01488.3  9DFE C   97 G   85'

 matches the original group, cWW-tSS-tSH-L-R-tHS-L-cWW
Better:   1 Equal:   0 Score 0.00       CGAAGAAC*GGGAG (   1) MLPS  -6.66 deficit   0.27 prct   0.00 CutScore  98.53;  Ed  0, 0
ans =

    ' IL_01488.3  4V9F C   93 G   81'

 scores better against   1 groups: IL_70923.9, 12 NTs, cWW-tSS-tSH-L-tHS-tHS-cWW               , Ed  0, 0, MLPS -5.50, deficit  0.00, prct   0.00; 
Better:   0 Equal:   0 Score 1.00       CGAGGAUC*GGGAG (   1) MLPS  -6.72 deficit   0.34 prct   0.00 CutScore  98.17;  Ed  0, 0
ans =

    ' IL_01488.3  4GXY C  139 G   86'

 matches the original group, cWW-tSS-tSH-L-R-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00       CAUCGAUC*GGGAG (   1) MLPS  -6.81 deficit   0.42 prct   0.00 CutScore  97.72;  Ed  0, 0
ans =

    ' IL_01488.3  6UFG C    3 G   27'

 matches the original group, cWW-tSS-tSH-L-R-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00       CAUCGAUC*GGGAG (   1) MLPS  -6.81 deficit   0.42 prct   0.00 CutScore  97.72;  Ed  0, 0
ans =

    ' IL_01488.3  6UFH C    3 G   27'

 matches the original group, cWW-tSS-tSH-L-R-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00       CUUUGAUC*GGGAG (   1) MLPS  -8.51 deficit   2.12 prct   0.00 CutScore  88.44;  Ed  0, 0
ans =

    ' IL_01488.3  4WF9 C   97 G   85'

 matches the original group, cWW-tSS-tSH-L-R-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00       CAGAGAUG*CGGAG (   1) MLPS  -9.46 deficit   3.07 prct   0.00 CutScore  83.27;  Ed  0, 0
ans =

    ' IL_01488.3  1T0K C   54 G   13'

 matches the original group, cWW-tSS-tSH-L-R-tHS-L-cWW
Better:   0 Equal:   0 Score 1.00       CGUAGAGA*UGUAG (   1) MLPS -10.85 deficit   4.47 prct   0.00 CutScore  75.69;  Ed  0, 0
ans =

    ' IL_01488.3  5J7L C  699 G  688'

 matches the original group, cWW-tSS-tSH-L-R-tHS-L-cWW
Better:   1 Equal:   0 Score 0.00       CCAUGACG*CAGAG (   1) MLPS -12.50 deficit   6.11 prct   0.00 CutScore  66.76;  Ed  0, 0
ans =

    ' IL_01488.3  9L6Y C   21 G   10'

 scores better against   1 groups: IL_70923.9, 12 NTs, cWW-tSS-tSH-L-tHS-tHS-cWW               , Ed  3, 3, MLPS -11.61, deficit  6.11, prct   0.00; 
Group 304 is from IL_74051.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_74051.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSS-tSH-L-tHS-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        CGGUGAAG*CGAG (   1) MLPS  -4.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_74051.1  5XTM C   16 G   33'

 matches the original group, cWW-tSS-tSH-L-tHS-cWW-L
Better:   0 Equal:   0 Score 1.00        CGGUGAAG*CGAG (   1) MLPS  -4.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_74051.1  5DCV C   18 G   35'

 matches the original group, cWW-tSS-tSH-L-tHS-cWW-L
Better:   0 Equal:   0 Score 1.00        CGGUGAAG*CGAG (   1) MLPS  -4.79 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_74051.1  5XTM C   16 G   33'

 matches the original group, cWW-tSS-tSH-L-tHS-cWW-L
Group 295 is from IL_70923.9 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_70923.9
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tSS-tSH-L-tHS-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  5G4T C    3 G   17'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  6Q8V C    3 G   17'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  5FJC C   31 G   21'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  6Q8U C    4 G   18'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  6Q8U C    4 G   18'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  7JRS C   77 G   59'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  7JRR C   23 G    9'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  5FJ4 C   26 G    7'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  7JRS C   12 G  124'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  7JRS C   77 G   59'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  4BW0 C   16 G    7'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAAGAAC*GGGAG (   1) MLPS  -5.50 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_70923.9  7JRS C   12 G  124'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAUGAAG*UGGAG (   1) MLPS  -6.18 deficit   0.68 prct   0.00 CutScore  96.26;  Ed  0, 0
ans =

    ' IL_70923.9  9DFE C 1208 G 1238'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGAUGAAA*UGGAG (   1) MLPS  -6.52 deficit   1.02 prct   0.00 CutScore  94.39;  Ed  0, 0
ans =

    ' IL_70923.9  3V7E C   31 G   21'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGGAGAAG*UGGAG (   1) MLPS  -7.53 deficit   2.03 prct   0.00 CutScore  88.84;  Ed  0, 0
ans =

    ' IL_70923.9  7A0S C 1221 G 1251'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CGUUGAAG*UGGAG (   1) MLPS  -7.99 deficit   2.50 prct   0.00 CutScore  86.30;  Ed  0, 0
ans =

    ' IL_70923.9  4WF9 C 1246 G 1276'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CUAUGAAG*UGGAG (   1) MLPS  -8.18 deficit   2.69 prct   0.00 CutScore  85.25;  Ed  0, 0
ans =

    ' IL_70923.9  7EAG C    3 G   17'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CUAUGAAG*UGGAG (   1) MLPS  -8.18 deficit   2.69 prct   0.00 CutScore  85.25;  Ed  0, 0
ans =

    ' IL_70923.9  7EAG C    3 G   17'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   1 Equal:   0 Score 0.00       AGACGAUC*GGGAU (   1) MLPS  -8.77 deficit   3.27 prct   0.00 CutScore  82.04;  Ed  0, 0
ans =

    ' IL_70923.9  5Y7M A   17 U   33'

 scores better against   1 groups: IL_01488.3, 12 NTs, cWW-tSS-tSH-L-R-tHS-L-cWW               , Ed  2, 0, MLPS -7.46, deficit  1.07, prct   0.00; 
Better:   0 Equal:   0 Score 1.00       CGACGAAG*CAGAG (   1) MLPS  -8.84 deficit   3.35 prct   0.00 CutScore  81.62;  Ed  0, 0
ans =

    ' IL_70923.9  4KQY C   31 G   21'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UGACGAAG*UCGAA (   1) MLPS  -9.62 deficit   4.12 prct   0.00 CutScore  77.36;  Ed  0, 0
ans =

    ' IL_70923.9  8P9A U 1388 A 1419'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       UGACGAAG*UCGAA (   1) MLPS  -9.62 deficit   4.12 prct   0.00 CutScore  77.36;  Ed  0, 0
ans =

    ' IL_70923.9  8CRE U 1384 A 1415'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CUGUGAAC*GGGAG (   1) MLPS  -9.78 deficit   4.28 prct   0.00 CutScore  76.48;  Ed  0, 0
ans =

    ' IL_70923.9  3U4M C 2129 G 2159'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CUUUGAAG*UGGAG (   1) MLPS -10.00 deficit   4.50 prct   0.00 CutScore  75.28;  Ed  0, 0
ans =

    ' IL_70923.9  5J7L C 2129 G 2159'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   0 Equal:   0 Score 1.00       CUGCGAAG*UGGAG (   1) MLPS -10.43 deficit   4.94 prct   0.00 CutScore  72.89;  Ed  0, 0
ans =

    ' IL_70923.9  5J7L C 1208 G 1238'

 matches the original group, cWW-tSS-tSH-L-tHS-tHS-cWW
Better:   1 Equal:   0 Score 0.00       UGAUGACC*GCAAG (   1) MLPS -11.92 deficit   6.42 prct   0.00 CutScore  64.73;  Ed  0, 0
ans =

    ' IL_70923.9  4C4W U   26 G    7'

 scores better against   1 groups: IL_94910.1, 12 NTs, cWW-tSS-tSH-L-R-R-L-cWW-L               , Ed  0, 0, MLPS -7.16, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00       GAUGGAAG*UGGAC (   1) MLPS -13.22 deficit   7.73 prct   0.00 CutScore  57.59;  Ed  0, 0
ans =

    ' IL_70923.9  4V9F G 1312 C 1342'

 scores better against   1 groups: IL_01488.3, 12 NTs, cWW-tSS-tSH-L-R-tHS-L-cWW               , Ed  6, 2, MLPS -11.84, deficit  5.45, prct   0.00; 
Group 150 is from IL_37015.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_37015.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tSS-tSS-tHH-L-tHS-L-R-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CGUUAUAAC*GUAAG (   1) MLPS  -8.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_37015.1  5J7L C   97 G   85'

 matches the original group, cWW-tSS-tSS-tHH-L-tHS-L-R-cWW-L
Group 211 is from IL_52743.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_52743.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tSW-L-cSW-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          GACAAGA*UAC (   1) MLPS  -3.94 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_52743.1  5NWQ G   29 C   20'

 matches the original group, cWW-tSW-L-cSW-L-cWW-L
Group 106 is from IL_25573.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_25573.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tSW-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           GGUAAC*GAC (   1) MLPS  -3.61 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_25573.1  1F1T G   23 C   10'

 matches the original group, cWW-tSW-L-cWW-L-L
Group 330 is from IL_80412.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_80412.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSW-L-cWW-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        AGCCUCCA*UAAU (   1) MLPS  -8.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_80412.1  6P2H A   45 U   25'

 matches the original group, cWW-tSW-L-cWW-L-L-R-L
Group  76 is from IL_18472.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_18472.4
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tSW-R-L-R-L-R-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GGAACC*GAAAC (   1) MLPS  -5.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_18472.4  9DFE G   23 C   60'

 matches the original group, cWW-tSW-R-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00         GGAACC*GAAAC (   1) MLPS  -5.45 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_18472.4  7A0S G   25 C   62'

 matches the original group, cWW-tSW-R-L-R-L-R-cWW
Better:   0 Equal:   0 Score 1.00         GGUCCC*GAAAC (   1) MLPS  -6.60 deficit   1.16 prct   0.00 CutScore  93.32;  Ed  0, 0
ans =

    ' IL_18472.4  5J7L G   23 C   60'

 matches the original group, cWW-tSW-R-L-R-L-R-cWW
Group 273 is from IL_67623.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_67623.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-tSW-cSW-L-cSW-L-R-L-cWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      GGUUGCCU*AUAAGC (   1) MLPS  -6.16 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67623.1  4V9F G   21 C   59'

 matches the original group, cWW-tSW-cSW-L-cSW-L-R-L-cWW-cWW
Group 265 is from IL_65653.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_65653.1
This group is considered to be structured ***************************
Number of NTs: 16  Signature: cWW-tSW-tHW-tWW-tWH-cSH-L-L-tHS-L-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00  GAUUGUAAACAG*CGACAC (   1) MLPS  -7.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65653.1  8HZL G    5 C   80'

 matches the original group, cWW-tSW-tHW-tWW-tWH-cSH-L-L-tHS-L-cWW-L
Better:   0 Equal:   0 Score 1.00  GAUUGUAAACAG*CGACAC (   1) MLPS  -7.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65653.1  8HZL G   20 C   71'

 matches the original group, cWW-tSW-tHW-tWW-tWH-cSH-L-L-tHS-L-cWW-L
Better:   0 Equal:   0 Score 1.00  GAUUGUAAACAU*AGACAC (   1) MLPS  -7.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65653.1  8HZL G   35 C   62'

 matches the original group, cWW-tSW-tHW-tWW-tWH-cSH-L-L-tHS-L-cWW-L
Better:   0 Equal:   0 Score 1.00  GAUUGUAAACAU*AGACAC (   1) MLPS  -7.66 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_65653.1  8HZE G    5 C   32'

 matches the original group, cWW-tSW-tHW-tWW-tWH-cSH-L-L-tHS-L-cWW-L
Group   5 is from IL_01038.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_01038.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tWH-L-R-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         GCAAG*UGAAAC (   1) MLPS  -6.81 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_01038.1  3OXE G   38 C   66'

 matches the original group, cWW-tWH-L-R-tHS-cWW
Group 155 is from IL_38507.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_38507.2
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tWH-L-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CUAAG*CGAAG (   1) MLPS  -5.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38507.2  5J7L C  998 G 1157'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CUAAG*CGAAG (   1) MLPS  -5.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38507.2  4WF9 C 1042 G 1201'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CUAAG*CGAAG (   1) MLPS  -5.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38507.2  9DFE C  998 G 1157'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CUAAG*CGAAG (   1) MLPS  -5.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38507.2  7A0S C 1009 G 1168'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CUAAG*CGAAG (   1) MLPS  -5.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38507.2  5J7L C 1577 G 1421'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CUAAG*CGAAG (   1) MLPS  -5.09 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38507.2  9DFE C 1351 G 1380'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CUAAG*CGAUG (   1) MLPS  -6.11 deficit   1.02 prct   0.00 CutScore  91.69;  Ed  0, 0
ans =

    ' IL_38507.2  9DFE C 1577 G 1421'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          CUAAA*UGAUG (   1) MLPS  -6.46 deficit   1.37 prct   0.00 CutScore  88.84;  Ed  0, 0
ans =

    ' IL_38507.2  7A0S C 1593 G 1435'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00         CUAAG*CGAAAG (   1) MLPS  -7.36 deficit   2.27 prct   0.00 CutScore  81.54;  Ed  0, 0
ans =

    ' IL_38507.2  8CRE C 1528 G 1586'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00         CUAAG*CGAAAG (   1) MLPS  -7.36 deficit   2.27 prct   0.00 CutScore  81.54;  Ed  0, 0
ans =

    ' IL_38507.2  8P9A C 1532 G 1590'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          AUUAU*AGAAU (   1) MLPS  -7.49 deficit   2.40 prct   0.00 CutScore  80.47;  Ed  0, 0
ans =

    ' IL_38507.2  8P9A A 3103 U 3131'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          AUUAU*AGAAU (   1) MLPS  -7.49 deficit   2.40 prct   0.00 CutScore  80.47;  Ed  0, 0
ans =

    ' IL_38507.2  8CRE A 3075 U 3103'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UUAAG*CGAGA (   1) MLPS  -7.51 deficit   2.42 prct   0.00 CutScore  80.29;  Ed  0, 0
ans =

    ' IL_38507.2  4V9F U 1095 A 1261'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UUAAG*CUAUA (   1) MLPS  -8.21 deficit   3.12 prct   0.00 CutScore  74.64;  Ed  0, 0
ans =

    ' IL_38507.2  8P9A U 1167 A 1332'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   0 Equal:   0 Score 1.00          UUAAA*UUAUA (   1) MLPS  -8.56 deficit   3.47 prct   0.00 CutScore  71.79;  Ed  0, 0
ans =

    ' IL_38507.2  8CRE U 1163 A 1328'

 matches the original group, cWW-tWH-L-tHS-cWW
Better:   7 Equal:   0 Score 0.00           CUGAC*GGUG (   1) MLPS -12.08 deficit   6.99 prct   0.00 CutScore  43.19;  Ed  0, 0
ans =

    ' IL_38507.2  9DFE C  846 G  931'

 scores better against   7 groups: IL_62012.1,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  7, 3, MLPS -8.09, deficit  1.71, prct   0.00; IL_64231.5,  9 NTs, cWW-cWW-L-R-L-cWW                       , Ed  1, 1, MLPS -8.41, deficit  1.73, prct   0.00; IL_11399.2,  9 NTs, cWW-cHW-L-R-L-cWW                       , Ed  4, 2, MLPS -9.05, deficit  4.34, prct   0.00; IL_85033.2,  8 NTs, cWW-cWW-cWW-cWW                         , Ed  2, 1, MLPS -10.36, deficit  4.02, prct   0.00; IL_29471.1, 10 NTs, cWW-cWW-L-tHS-L-cWW                     , Ed  3, 1, MLPS -10.96, deficit  4.67, prct   0.00; 
Group 390 is from IL_94684.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_94684.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tWH-R-L-cWW-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           UGGAAG*CUA (   1) MLPS  -3.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_94684.1  8CRE U 1393 A 1377'

 matches the original group, cWW-tWH-R-L-cWW-L-L
Better:   0 Equal:   0 Score 1.00           UGGAAG*CUA (   1) MLPS  -3.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_94684.1  8P9A U 1407 A 1391'

 matches the original group, cWW-tWH-R-L-cWW-L-L
Group  72 is from IL_17765.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_17765.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-tWH-cHW-L-tSS-cSS-cWW-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CUGAGAAAGUC*GGUG (   1) MLPS  -8.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_17765.1  3D2V C   26 G   13'

 matches the original group, cWW-tWH-cHW-L-tSS-cSS-cWW-R-L
Group 212 is from IL_53448.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_53448.1
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tWH-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CUAAG*UAUG (   1) MLPS  -4.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53448.1  5BTM C   19 G   37'

 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00           CUAAG*UAUG (   1) MLPS  -4.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53448.1  5XTM C   41 G    6'

 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00           CUAAG*UAUG (   1) MLPS  -4.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53448.1  6AZ4 C   13 G   31'

 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00           CUAAG*UAUG (   1) MLPS  -4.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53448.1  4K27 C   19 G   37'

 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00           CUAAG*UAUG (   1) MLPS  -4.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53448.1  1KXK C   15 G   57'

 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00           CUAAG*UAUG (   1) MLPS  -4.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53448.1  5M0H C   14 G   32'

 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00           CUAAG*UAUG (   1) MLPS  -4.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53448.1  6DVK C   85 G    9'

 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00           CUAAG*UAUG (   1) MLPS  -4.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53448.1  6WPI C   18 G   36'

 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00           CUAAG*UAUG (   1) MLPS  -4.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53448.1  2R8S C  223 G  250'

 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00           CUAAG*UAUG (   1) MLPS  -4.02 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53448.1  5Y7M C   46 G    6'

 matches the original group, cWW-tWH-cSH-cWW
Better:   0 Equal:   0 Score 1.00           CUACG*UAUG (   1) MLPS  -4.35 deficit   0.32 prct   0.00 CutScore  98.05;  Ed  0, 0
ans =

    ' IL_53448.1  1NBS C  146 G  162'

 matches the original group, cWW-tWH-cSH-cWW
Group 154 is from IL_38394.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_38394.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tWH-cWW-L-L-R-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          CUGAGAAA*UG (   1) MLPS  -5.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38394.1  8F4O C   38 G   21'

 matches the original group, cWW-tWH-cWW-L-L-R-L
Better:   0 Equal:   0 Score 1.00          CUGAGAAA*UG (   1) MLPS  -5.43 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_38394.1  7TZS C   38 G   21'

 matches the original group, cWW-tWH-cWW-L-L-R-L
Group  13 is from IL_03350.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_03350.1
This group is considered to be structured ***************************
Number of NTs: 13  Signature: cWW-tWH-cWW-L-L-cWW-L-L-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       CUACCCACC*GAGG (   1) MLPS  -7.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_03350.1  5CNR C    5 G   41'

 matches the original group, cWW-tWH-cWW-L-L-cWW-L-L-L
Better:   0 Equal:   0 Score 1.00       CUACCCACC*GAGG (   1) MLPS  -7.29 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_03350.1  4P97 C    5 G   41'

 matches the original group, cWW-tWH-cWW-L-L-cWW-L-L-L
Better:   0 Equal:   0 Score 1.00       CUCCCCACC*GAGG (   1) MLPS  -7.81 deficit   0.51 prct   0.00 CutScore  97.45;  Ed  0, 0
ans =

    ' IL_03350.1  4PHY C    5 G   41'

 matches the original group, cWW-tWH-cWW-L-L-cWW-L-L-L
Group 180 is from IL_44624.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_44624.1
This group is considered to be structured ***************************
Number of NTs: 14  Signature: cWW-tWH-cWW-L-cWW-tSS-cSS-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00     CUGAGAAAUAC*GGUG (   1) MLPS  -8.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_44624.1  7TZS C   38 G   21'

 matches the original group, cWW-tWH-cWW-L-cWW-tSS-cSS-cWW-L
Better:   0 Equal:   0 Score 1.00     CUGAGAAAUAC*GGUG (   1) MLPS  -8.06 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_44624.1  8F4O C   38 G   21'

 matches the original group, cWW-tWH-cWW-L-cWW-tSS-cSS-cWW-L
Group 274 is from IL_67767.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_67767.4
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tWH-cWW-cSH-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   1 Equal:   0 Score 0.00           CUAAG*UAUG (   1) MLPS  -4.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67767.4  5VCI C    8 G    5'

 scores better against   1 groups: IL_53448.1,  8 NTs, cWW-tWH-cSH-cWW                         , Ed  0, 0, MLPS -4.02, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CUAAG*UAUG (   1) MLPS  -4.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67767.4  4PCJ C    8 G   28'

 scores better against   1 groups: IL_53448.1,  8 NTs, cWW-tWH-cSH-cWW                         , Ed  0, 0, MLPS -4.02, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CUAAG*UAUG (   1) MLPS  -4.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67767.4  1U6B C  147 G  163'

 scores better against   1 groups: IL_53448.1,  8 NTs, cWW-tWH-cSH-cWW                         , Ed  0, 0, MLPS -4.02, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CUAAG*UAUG (   1) MLPS  -4.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67767.4  5DCV C   45 G    6'

 scores better against   1 groups: IL_53448.1,  8 NTs, cWW-tWH-cSH-cWW                         , Ed  0, 0, MLPS -4.02, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CUAAG*UAUG (   1) MLPS  -4.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67767.4  3IGI C  346 G  335'

 scores better against   1 groups: IL_53448.1,  8 NTs, cWW-tWH-cSH-cWW                         , Ed  0, 0, MLPS -4.02, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CUAAG*UAUG (   1) MLPS  -4.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67767.4  5XTM C   41 G    6'

 scores better against   1 groups: IL_53448.1,  8 NTs, cWW-tWH-cSH-cWW                         , Ed  0, 0, MLPS -4.02, deficit  0.00, prct   0.00; 
Better:   1 Equal:   0 Score 0.00           CUAAG*UAUG (   1) MLPS  -4.13 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67767.4  1U6B C   61 G   83'

 scores better against   1 groups: IL_53448.1,  8 NTs, cWW-tWH-cSH-cWW                         , Ed  0, 0, MLPS -4.02, deficit  0.00, prct   0.00; 
Group  82 is from IL_19852.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_19852.1
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tWH-cWW-cWH-cWH-cWH
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       AGGUGGGUGGU*AU (   1) MLPS  -6.24 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_19852.1  8EYU A   16 U   38'

 matches the original group, cWW-tWH-cWW-cWH-cWH-cWH
Group   4 is from IL_00981.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_00981.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tWH-tHH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         UUAAC*GGAAGA (   1) MLPS  -4.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00981.1  8P9A U 1694 A 1752'

 matches the original group, cWW-tWH-tHH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         UUAAC*GGAAGA (   1) MLPS  -4.39 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_00981.1  8CRE U 1690 A 1748'

 matches the original group, cWW-tWH-tHH-tHS-cWW
Group 410 is from IL_99646.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_99646.2
This group is considered to be structured ***************************
Number of NTs:  8  Signature: cWW-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00           CUAG*CGAAG (   1) MLPS  -6.52 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_99646.2  9DFE C 1437 G 1555'

 matches the original group, cWW-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           CUAG*CGAUG (   1) MLPS  -6.52 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_99646.2  4WF9 C 1624 G 1465'

 matches the original group, cWW-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           AUAG*CGAAU (   1) MLPS  -6.62 deficit   0.10 prct   0.00 CutScore  99.07;  Ed  0, 0
ans =

    ' IL_99646.2  9DFE A  357 U  284'

 matches the original group, cWW-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           CUAU*AAAUG (   1) MLPS  -6.86 deficit   0.33 prct   0.00 CutScore  96.91;  Ed  0, 0
ans =

    ' IL_99646.2  5J7L C 1437 G 1555'

 matches the original group, cWW-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           AUAG*CGAGU (   1) MLPS  -7.14 deficit   0.61 prct   0.00 CutScore  94.31;  Ed  0, 0
ans =

    ' IL_99646.2  2ZY6 A    7 U   29'

 matches the original group, cWW-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00           CUAU*AAACG (   1) MLPS  -7.37 deficit   0.84 prct   0.00 CutScore  92.15;  Ed  0, 0
ans =

    ' IL_99646.2  7A0S C 1451 G 1571'

 matches the original group, cWW-tWH-tHS-cWW
Group  53 is from IL_12745.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_12745.1
This group is considered to be structured ***************************
Number of NTs: 12  Signature: cWW-tWH-tWH-tHW-tHW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00       GACAAC*GCUAAUC (   1) MLPS  -6.72 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_12745.1  4LFB G  148 C  174'

 matches the original group, cWW-tWH-tWH-tHW-tHW-cWW
Group 384 is from IL_91698.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_91698.1
This group is considered to be structured ***************************
Number of NTs: 17  Signature: cWW-tWW-L-R-L-R-L-R-L-tHW-R-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00   UUGUGAAAC*GCCAGCGA (   1) MLPS  -6.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_91698.1  8P9A U 1519 A 1487'

 matches the original group, cWW-tWW-L-R-L-R-L-R-L-tHW-R-L-cWW
Better:   0 Equal:   0 Score 1.00   UUGUGAAAC*GCCAGCGA (   1) MLPS  -6.73 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_91698.1  8CRE U 1506 A 1473'

 matches the original group, cWW-tWW-L-R-L-R-L-R-L-tHW-R-L-cWW
Group 213 is from IL_53581.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_53581.1
This group is considered to be structured ***************************
Number of NTs: 22  Signature: cWW-tWW-L-tWH-cSS-tSS-tWH-cSS-tWH-R-tSS-R-L-L-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GAGAAUGUUAUGG*CAGAGAAAAC (   1) MLPS  -7.67 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53581.1  6SY6 G    5 C   35'

 matches the original group, cWW-tWW-L-tWH-cSS-tSS-tWH-cSS-tWH-R-tSS-R-L-L-cWW-L-cWW
Better:   0 Equal:   0 Score 1.00 GAGAAUGUUAUGG*CAGAGAAAAC (   1) MLPS  -7.67 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_53581.1  6SY4 G    6 C   38'

 matches the original group, cWW-tWW-L-tWH-cSS-tSS-tWH-cSS-tWH-R-tSS-R-L-L-cWW-L-cWW
Group 317 is from IL_77278.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_77278.1
This group is considered to be structured ***************************
Number of NTs: 10  Signature: cWW-tWW-L-tWW-cWW-L
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00      CUCAUCAG*CUCAAG (   1) MLPS  -7.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77278.1  8CRE C 1183 G 1315'

 matches the original group, cWW-tWW-L-tWW-cWW-L
Better:   0 Equal:   0 Score 1.00      CUCAUCAG*CUCAAG (   1) MLPS  -7.53 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_77278.1  8P9A C 1187 G 1319'

 matches the original group, cWW-tWW-L-tWW-cWW-L
Group 227 is from IL_57188.5 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_57188.5
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tWW-L-tWW-cWW-cSH
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00        UUAAGUG*CUAAA (   1) MLPS  -6.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_57188.5  5J7L U 1018 A 1144'

 matches the original group, cWW-tWW-L-tWW-cWW-cSH
Better:   0 Equal:   0 Score 1.00        UUAAGUG*CUAAA (   1) MLPS  -6.65 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_57188.5  4WF9 U 1062 A 1188'

 matches the original group, cWW-tWW-L-tWW-cWW-cSH
Better:   0 Equal:   0 Score 1.00       UUAAGUG*CUCAAA (   1) MLPS  -6.94 deficit   0.30 prct   0.00 CutScore  98.44;  Ed  0, 0
ans =

    ' IL_57188.5  4V9F U 1115 A 1248'

 matches the original group, cWW-tWW-L-tWW-cWW-cSH
Better:   0 Equal:   0 Score 1.00       CUAAGUG*CUUAAG (   1) MLPS  -7.50 deficit   0.86 prct   0.00 CutScore  95.50;  Ed  0, 0
ans =

    ' IL_57188.5  9DFE C 1018 G 1144'

 matches the original group, cWW-tWW-L-tWW-cWW-cSH
Better:   0 Equal:   0 Score 1.00       CUCAGUG*CUCAAG (   1) MLPS  -8.09 deficit   1.44 prct   0.00 CutScore  92.41;  Ed  0, 0
ans =

    ' IL_57188.5  7A0S C 1029 G 1155'

 matches the original group, cWW-tWW-L-tWW-cWW-cSH
Group 371 is from IL_88269.4 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_88269.4
This group is considered to be structured ***************************
Number of NTs: 11  Signature: cWW-tWW-cSH-tWH-tHS-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00         CGUUAC*GGAGG (   1) MLPS  -7.64 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_88269.4  5J7L C  483 G  450'

 matches the original group, cWW-tWW-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00        UAUGUAG*UGAAA (   1) MLPS  -8.20 deficit   0.56 prct   0.00 CutScore  96.85;  Ed  0, 0
ans =

    ' IL_88269.4  5J7L U 1712 A 1746'

 matches the original group, cWW-tWW-cSH-tWH-tHS-cWW
Better:   0 Equal:   0 Score 1.00         CGGUAC*GGACG (   1) MLPS  -8.22 deficit   0.57 prct   0.00 CutScore  96.76;  Ed  0, 0
ans =

    ' IL_88269.4  4LFB C  483 G  450'

 matches the original group, cWW-tWW-cSH-tWH-tHS-cWW
Group 272 is from IL_67095.2 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_67095.2
This group is considered to be structured ***************************
Number of NTs:  6  Signature: cWW-tWW-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00              UAG*CCA (   1) MLPS  -4.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67095.2  4V9F U 1741 A 2038'

 matches the original group, cWW-tWW-cWW
Better:   0 Equal:   0 Score 1.00              UAA*UCA (   1) MLPS  -4.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67095.2  4WF9 U 1707 A 2024'

 matches the original group, cWW-tWW-cWW
Better:   0 Equal:   0 Score 1.00              UAA*UCA (   1) MLPS  -4.18 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_67095.2  7A0S U 1680 A 1980'

 matches the original group, cWW-tWW-cWW
Better:   0 Equal:   0 Score 1.00              AAG*CCU (   1) MLPS  -4.26 deficit   0.08 prct   0.00 CutScore  99.14;  Ed  0, 0
ans =

    ' IL_67095.2  8CRE A 1891 U 2318'

 matches the original group, cWW-tWW-cWW
Better:   0 Equal:   0 Score 1.00              AAG*CCU (   1) MLPS  -4.26 deficit   0.08 prct   0.00 CutScore  99.14;  Ed  0, 0
ans =

    ' IL_67095.2  8P9A A 1895 U 2340'

 matches the original group, cWW-tWW-cWW
Better:   0 Equal:   0 Score 1.00              CAA*UCG (   1) MLPS  -4.31 deficit   0.13 prct   0.00 CutScore  98.60;  Ed  0, 0
ans =

    ' IL_67095.2  9DFE C 1663 G 1997'

 matches the original group, cWW-tWW-cWW
Better:   0 Equal:   0 Score 1.00              GAA*UCC (   1) MLPS  -4.31 deficit   0.14 prct   0.00 CutScore  98.54;  Ed  0, 0
ans =

    ' IL_67095.2  5J7L G 1663 C 1997'

 matches the original group, cWW-tWW-cWW
Better:   7 Equal:   0 Score 0.00             UAG*CAGG (   1) MLPS  -9.30 deficit   5.12 prct   0.00 CutScore  46.08;  Ed  0, 0
ans =

    ' IL_67095.2  9DFE U 1433 G 1560'

 scores better against   7 groups: IL_85599.2,  6 NTs, cWW-tHS-cWW                             , Ed  1, 1, MLPS -5.68, deficit  0.82, prct   0.00; IL_55516.2,  7 NTs, cWW-cWW-cSH-cWW                         , Ed  3, 1, MLPS -6.32, deficit  0.71, prct   0.00; IL_96371.1,  6 NTs, cWW-tHH-cWW                             , Ed  1, 1, MLPS -7.33, deficit  3.06, prct   0.00; IL_57744.1,  6 NTs, cWW-cWW-cWW                             , Ed  1, 0, MLPS -7.80, deficit  2.88, prct   0.00; IL_15698.3,  7 NTs, cWW-L-R-L-cWW                           , Ed  2, 2, MLPS -7.88, deficit  3.40, prct   0.00; 
Group 397 is from IL_96236.1 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_96236.1
This group is considered to be structured ***************************
Number of NTs:  9  Signature: cWW-tWW-cWW-L-cWW
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00          AAUUC*GUUAU (   1) MLPS  -5.41 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_96236.1  5J7L A  844 U  934'

 matches the original group, cWW-tWW-cWW-L-cWW
Group 146 is from IL_34739.3 which you can see at http://rna.bgsu.edu/rna3dhub/motif/view/IL_34739.3
This group is considered to be structured ***************************
Number of NTs: 20  Signature: cWW-tWW-tWW-L-R-L-R-L-cWW-L-L-R-L-R-L-R-L-R
100.00% of rows in the alignment have core edit distance 0 from a sequence in 3D
Sequence (multiplicity in alignment) percentile, core edit distance
Better:   0 Equal:   0 Score 1.00 GAAACAAUACAGAGAUGAUCA*UUUAC (   1) MLPS -11.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_34739.3  4N0T G   39 C   92'

 matches the original group, cWW-tWW-tWW-L-R-L-R-L-cWW-L-L-R-L-R-L-R-L-R
Better:   0 Equal:   0 Score 1.00 GAAACAAUACAGAGAUGAUCA*UUUAC (   1) MLPS -11.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_34739.3  6ASO G   39 C   92'

 matches the original group, cWW-tWW-tWW-L-R-L-R-L-cWW-L-L-R-L-R-L-R-L-R
Better:   0 Equal:   0 Score 1.00 GAAACAAUACAGAGAUGAUCA*UUUAC (   1) MLPS -11.35 deficit   0.00 prct   0.00 CutScore 100.00;  Ed  0, 0
ans =

    ' IL_34739.3  5VSU G   39 C   92'

 matches the original group, cWW-tWW-tWW-L-R-L-R-L-cWW-L-L-R-L-R-L-R-L-R
Sequence    1 in group IL_00225.13 with cutoff score    97.1079 does better against group IL_16386.4 cutoff score    97.7989; CGA*UG
Sequence    3 in group IL_00225.13 with cutoff score    97.6627 does better against group IL_07039.3 cutoff score    97.9437; UGA*UG
Sequence   10 in group IL_00225.13 with cutoff score    91.7495 does better against group IL_16386.4 cutoff score    95.3269; AGU*AU
Sequence   10 in group IL_00225.13 with cutoff score    91.7495 does better against group IL_66635.5 cutoff score    91.9892; AGU*AU
Sequence   12 in group IL_00225.13 with cutoff score    91.7495 does better against group IL_16386.4 cutoff score    95.3269; AGU*AU
Sequence   12 in group IL_00225.13 with cutoff score    91.7495 does better against group IL_66635.5 cutoff score    91.9892; AGU*AU
Sequence   16 in group IL_00225.13 with cutoff score    94.1157 does better against group IL_16386.4 cutoff score    95.4625; UGU*AA
Sequence   18 in group IL_00225.13 with cutoff score    97.6627 does better against group IL_07039.3 cutoff score    97.9437; UGA*UG
Sequence   20 in group IL_00225.13 with cutoff score    91.7495 does better against group IL_16386.4 cutoff score    95.3269; AGU*AU
Sequence   20 in group IL_00225.13 with cutoff score    91.7495 does better against group IL_66635.5 cutoff score    91.9892; AGU*AU
Sequence   21 in group IL_00225.13 with cutoff score    97.6627 does better against group IL_07039.3 cutoff score    97.9437; UGA*UG
Sequence   27 in group IL_00225.13 with cutoff score    94.1157 does better against group IL_16386.4 cutoff score    95.4625; UGU*AA
Sequence   29 in group IL_00225.13 with cutoff score    94.6037 does better against group IL_07039.3 cutoff score   100.0000; UGG*CG
Sequence   29 in group IL_00225.13 with cutoff score    94.6037 does better against group IL_66635.5 cutoff score    96.6455; UGG*CG
Sequence   32 in group IL_00225.13 with cutoff score    93.8191 does better against group IL_16386.4 cutoff score    95.6869; GGA*UC
Sequence   32 in group IL_00225.13 with cutoff score    93.8191 does better against group IL_66635.5 cutoff score    97.1267; GGA*UC
Sequence   33 in group IL_00225.13 with cutoff score    93.8191 does better against group IL_16386.4 cutoff score    95.6869; GGA*UC
Sequence   33 in group IL_00225.13 with cutoff score    93.8191 does better against group IL_66635.5 cutoff score    97.1267; GGA*UC
Sequence   36 in group IL_00225.13 with cutoff score    94.5222 does better against group IL_16386.4 cutoff score    97.6633; CGU*AG
Sequence   38 in group IL_00225.13 with cutoff score    91.2763 does better against group IL_16386.4 cutoff score    97.6636; AGG*CU
Sequence   38 in group IL_00225.13 with cutoff score    91.2763 does better against group IL_66635.5 cutoff score    96.0249; AGG*CU
Sequence   41 in group IL_00225.13 with cutoff score    94.6037 does better against group IL_07039.3 cutoff score   100.0000; UGG*CG
Sequence   41 in group IL_00225.13 with cutoff score    94.6037 does better against group IL_66635.5 cutoff score    96.6455; UGG*CG
Sequence   45 in group IL_00225.13 with cutoff score    94.0490 does better against group IL_16386.4 cutoff score   100.0000; CGG*CG
Sequence   45 in group IL_00225.13 with cutoff score    94.0490 does better against group IL_66635.5 cutoff score    96.1600; CGG*CG
Sequence   48 in group IL_00225.13 with cutoff score    94.0490 does better against group IL_16386.4 cutoff score   100.0000; CGG*CG
Sequence   48 in group IL_00225.13 with cutoff score    94.0490 does better against group IL_66635.5 cutoff score    96.1600; CGG*CG
Sequence   52 in group IL_00881.1 with cutoff score    90.0353 does better against group IL_47078.3 cutoff score    94.9835; CACAA*UG
Sequence   67 in group IL_01488.3 with cutoff score    98.5314 does better against group IL_70923.9 cutoff score   100.0000; CGAAGAAC*GGGAG
Sequence   80 in group IL_02555.1 with cutoff score    97.7484 does better against group IL_00881.1 cutoff score    98.6655; UAAG*UA
Sequence   81 in group IL_02555.1 with cutoff score    97.7484 does better against group IL_00881.1 cutoff score    98.6655; UAAG*UA
Sequence   82 in group IL_02555.1 with cutoff score    61.6907 does better against group IL_00881.1 cutoff score    94.6180; CAAG*CG
Sequence   82 in group IL_02555.1 with cutoff score    61.6907 does better against group IL_15052.4 cutoff score    94.2893; CAAG*CG
Sequence   82 in group IL_02555.1 with cutoff score    61.6907 does better against group IL_42626.2 cutoff score    67.4615; CAAG*CG
Sequence   82 in group IL_02555.1 with cutoff score    61.6907 does better against group IL_68140.4 cutoff score    90.9171; CAAG*CG
Sequence   82 in group IL_02555.1 with cutoff score    61.6907 does better against group IL_73355.1 cutoff score    98.7544; CAAG*CG
Sequence   82 in group IL_02555.1 with cutoff score    61.6907 does better against group IL_73452.2 cutoff score    68.4211; CAAG*CG
Sequence   82 in group IL_02555.1 with cutoff score    61.6907 does better against group IL_76709.2 cutoff score    92.9234; CAAG*CG
Sequence   82 in group IL_02555.1 with cutoff score    61.6907 does better against group IL_81831.1 cutoff score    92.1199; CAAG*CG
Sequence   82 in group IL_02555.1 with cutoff score    61.6907 does better against group IL_82107.4 cutoff score    96.2397; CAAG*CG
Sequence   82 in group IL_02555.1 with cutoff score    61.6907 does better against group IL_95583.2 cutoff score    87.4391; CAAG*CG
Sequence   83 in group IL_02555.1 with cutoff score    62.2870 does better against group IL_15052.4 cutoff score    66.2340; CUAG*CG
Sequence   83 in group IL_02555.1 with cutoff score    62.2870 does better against group IL_42626.2 cutoff score    89.5885; CUAG*CG
Sequence   83 in group IL_02555.1 with cutoff score    62.2870 does better against group IL_56987.1 cutoff score    94.1352; CUAG*CG
Sequence   83 in group IL_02555.1 with cutoff score    62.2870 does better against group IL_66635.5 cutoff score    80.1925; CUAG*CG
Sequence   83 in group IL_02555.1 with cutoff score    62.2870 does better against group IL_68140.4 cutoff score    85.9015; CUAG*CG
Sequence   83 in group IL_02555.1 with cutoff score    62.2870 does better against group IL_73452.2 cutoff score   100.0000; CUAG*CG
Sequence   83 in group IL_02555.1 with cutoff score    62.2870 does better against group IL_82107.4 cutoff score    85.3040; CUAG*CG
Sequence   83 in group IL_02555.1 with cutoff score    62.2870 does better against group IL_84476.1 cutoff score    84.9642; CUAG*CG
Sequence   88 in group IL_03109.3 with cutoff score    50.5818 does better against group IL_20031.1 cutoff score    76.7711; UGGCC*GG
Sequence  102 in group IL_04332.3 with cutoff score    92.9194 does better against group IL_42218.2 cutoff score    98.3664; CGAAAUUCCUUG*CCUG
Sequence  131 in group IL_04785.1 with cutoff score    86.4627 does better against group IL_43644.1 cutoff score    92.8325; CCCG*CCCG
Sequence  131 in group IL_04785.1 with cutoff score    86.4627 does better against group IL_84251.1 cutoff score    93.8695; CCCG*CCCG
Sequence  173 in group IL_07785.1 with cutoff score    96.7649 does better against group IL_07785.1 cutoff score    97.6721; UUU*AUA
Sequence  176 in group IL_07785.1 with cutoff score    91.9480 does better against group IL_08770.1 cutoff score    94.1970; AUG*CCU
Sequence  176 in group IL_07785.1 with cutoff score    91.9480 does better against group IL_14688.1 cutoff score    98.1210; AUG*CCU
Sequence  180 in group IL_07785.1 with cutoff score    76.4639 does better against group IL_87907.2 cutoff score    78.7547; ACU*ACU
Sequence  181 in group IL_07785.1 with cutoff score    91.9480 does better against group IL_08770.1 cutoff score    94.1970; AUG*CCU
Sequence  181 in group IL_07785.1 with cutoff score    91.9480 does better against group IL_14688.1 cutoff score    98.1210; AUG*CCU
Sequence  183 in group IL_07785.1 with cutoff score    91.9480 does better against group IL_08770.1 cutoff score    94.1970; AUG*CCU
Sequence  183 in group IL_07785.1 with cutoff score    91.9480 does better against group IL_14688.1 cutoff score    98.1210; AUG*CCU
Sequence  184 in group IL_07785.1 with cutoff score    91.9480 does better against group IL_08770.1 cutoff score    94.1970; AUG*CCU
Sequence  184 in group IL_07785.1 with cutoff score    91.9480 does better against group IL_14688.1 cutoff score    98.1210; AUG*CCU
Sequence  187 in group IL_07785.1 with cutoff score    68.7577 does better against group IL_51387.2 cutoff score    95.8653; GUUU*AUC
Sequence  188 in group IL_07785.1 with cutoff score    77.4948 does better against group IL_55516.2 cutoff score    94.8235; GAC*GCAC
Sequence  189 in group IL_07785.1 with cutoff score    42.9483 does better against group IL_89984.3 cutoff score    44.5698; UUAUC*GUG
Sequence  193 in group IL_07785.1 with cutoff score    77.5083 does better against group IL_55516.2 cutoff score    91.5321; GAG*CCAC
Sequence  194 in group IL_07785.1 with cutoff score    71.6249 does better against group IL_51387.2 cutoff score    96.0099; GUUG*CUC
Sequence  195 in group IL_07785.1 with cutoff score    79.0700 does better against group IL_99358.1 cutoff score    93.0817; GUU*AUAC
Sequence  199 in group IL_07785.1 with cutoff score    70.8289 does better against group IL_51387.2 cutoff score    81.3478; UUUG*CUG
Sequence  200 in group IL_07785.1 with cutoff score    61.0631 does better against group IL_55516.2 cutoff score    63.6358; UAC*GCCA
Sequence  200 in group IL_07785.1 with cutoff score    61.0631 does better against group IL_99358.1 cutoff score    87.2620; UAC*GCCA
Sequence  202 in group IL_07785.1 with cutoff score    78.4843 does better against group IL_55516.2 cutoff score    94.5635; CAC*GCAG
Sequence  205 in group IL_07785.1 with cutoff score    54.6647 does better against group IL_10389.1 cutoff score    64.7913; CAG*CCCGG
Sequence  205 in group IL_07785.1 with cutoff score    54.6647 does better against group IL_19102.1 cutoff score    66.6992; CAG*CCCGG
Sequence  206 in group IL_08770.1 with cutoff score    96.8317 does better against group IL_31531.3 cutoff score   100.0000; GAAG*CAC
Sequence  206 in group IL_08770.1 with cutoff score    96.8317 does better against group IL_41344.1 cutoff score   100.0000; GAAG*CAC
Sequence  206 in group IL_08770.1 with cutoff score    96.8317 does better against group IL_90351.1 cutoff score    99.2616; GAAG*CAC
Sequence  207 in group IL_08770.1 with cutoff score    96.8317 does better against group IL_31531.3 cutoff score   100.0000; GAAG*CAC
Sequence  207 in group IL_08770.1 with cutoff score    96.8317 does better against group IL_41344.1 cutoff score   100.0000; GAAG*CAC
Sequence  207 in group IL_08770.1 with cutoff score    96.8317 does better against group IL_90351.1 cutoff score    99.2616; GAAG*CAC
Sequence  210 in group IL_08770.1 with cutoff score    95.4291 does better against group IL_14688.1 cutoff score   100.0000; ACA*UUU
Sequence  220 in group IL_09705.15 with cutoff score    94.7429 does better against group IL_85033.2 cutoff score    95.6141; AGAC*GGAU
Sequence  229 in group IL_09705.15 with cutoff score    75.8766 does better against group IL_80398.1 cutoff score   100.0000; UAAC*GAAA
Sequence  231 in group IL_09705.15 with cutoff score    93.8407 does better against group IL_85033.2 cutoff score   100.0000; GGAC*GGAC
Sequence  234 in group IL_09705.15 with cutoff score    95.1338 does better against group IL_09705.15 cutoff score    95.3458; CGAU*AGAG
Sequence  237 in group IL_09705.15 with cutoff score    95.1338 does better against group IL_09705.15 cutoff score    95.3458; CGAU*AGAG
Sequence  239 in group IL_09705.15 with cutoff score    82.2458 does better against group IL_09705.15 cutoff score    93.2375; GAAG*CGAC
Sequence  242 in group IL_09705.15 with cutoff score    41.5826 does better against group IL_05192.4 cutoff score    99.2675; AGAACG*CAAU
Sequence  242 in group IL_09705.15 with cutoff score    41.5826 does better against group IL_11344.2 cutoff score    74.7858; AGAACG*CAAU
Sequence  242 in group IL_09705.15 with cutoff score    41.5826 does better against group IL_18472.4 cutoff score    52.2853; AGAACG*CAAU
Sequence  242 in group IL_09705.15 with cutoff score    41.5826 does better against group IL_90346.1 cutoff score    44.9515; AGAACG*CAAU
Sequence  243 in group IL_09705.15 with cutoff score    41.5826 does better against group IL_05192.4 cutoff score    99.2675; AGAACG*CAAU
Sequence  243 in group IL_09705.15 with cutoff score    41.5826 does better against group IL_11344.2 cutoff score    74.7858; AGAACG*CAAU
Sequence  243 in group IL_09705.15 with cutoff score    41.5826 does better against group IL_18472.4 cutoff score    52.2853; AGAACG*CAAU
Sequence  243 in group IL_09705.15 with cutoff score    41.5826 does better against group IL_90346.1 cutoff score    44.9515; AGAACG*CAAU
Sequence  245 in group IL_09705.15 with cutoff score    72.3140 does better against group IL_09705.15 cutoff score    90.0339; GGAG*UGAC
Sequence  245 in group IL_09705.15 with cutoff score    72.3140 does better against group IL_85033.2 cutoff score    89.5626; GGAG*UGAC
Sequence  256 in group IL_10167.6 with cutoff score    90.0901 does better against group IL_44465.1 cutoff score   100.0000; UGA*UGA
Sequence  260 in group IL_10167.6 with cutoff score    90.3367 does better against group IL_44465.1 cutoff score    96.1861; GGU*AGC
Sequence  263 in group IL_10167.6 with cutoff score    93.2203 does better against group IL_44465.1 cutoff score    95.5204; GGC*GGC
Sequence  264 in group IL_10167.6 with cutoff score    90.0901 does better against group IL_44465.1 cutoff score   100.0000; UGA*UGA
Sequence  271 in group IL_10167.6 with cutoff score    90.0901 does better against group IL_44465.1 cutoff score   100.0000; UGA*UGA
Sequence  272 in group IL_10167.6 with cutoff score    68.1189 does better against group IL_14688.1 cutoff score    72.5965; AGU*AAU
Sequence  272 in group IL_10167.6 with cutoff score    68.1189 does better against group IL_44465.1 cutoff score    85.0565; AGU*AAU
Sequence  272 in group IL_10167.6 with cutoff score    68.1189 does better against group IL_57744.1 cutoff score    80.9732; AGU*AAU
Sequence  272 in group IL_10167.6 with cutoff score    68.1189 does better against group IL_87907.2 cutoff score    78.1246; AGU*AAU
Sequence  273 in group IL_10167.6 with cutoff score    90.0901 does better against group IL_44465.1 cutoff score   100.0000; UGA*UGA
Sequence  274 in group IL_10167.6 with cutoff score    73.6577 does better against group IL_44465.1 cutoff score    75.0290; UGG*UGG
Sequence  276 in group IL_10167.6 with cutoff score    93.2203 does better against group IL_44465.1 cutoff score    95.5204; GGC*GGC
Sequence  277 in group IL_10167.6 with cutoff score    73.6577 does better against group IL_44465.1 cutoff score    75.0290; UGG*UGG
Sequence  278 in group IL_10167.6 with cutoff score    93.2203 does better against group IL_44465.1 cutoff score    95.5204; GGC*GGC
Sequence  279 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_08770.1 cutoff score    73.7982; CAG*CAG
Sequence  279 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_14688.1 cutoff score    67.6215; CAG*CAG
Sequence  279 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_31737.3 cutoff score    99.5010; CAG*CAG
Sequence  279 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_42997.3 cutoff score    93.0857; CAG*CAG
Sequence  279 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_57744.1 cutoff score    83.7315; CAG*CAG
Sequence  279 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_87907.2 cutoff score    84.4250; CAG*CAG
Sequence  281 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_08770.1 cutoff score    73.7982; CAG*CAG
Sequence  281 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_14688.1 cutoff score    67.6215; CAG*CAG
Sequence  281 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_31737.3 cutoff score    99.5010; CAG*CAG
Sequence  281 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_42997.3 cutoff score    93.0857; CAG*CAG
Sequence  281 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_57744.1 cutoff score    83.7315; CAG*CAG
Sequence  281 in group IL_10167.6 with cutoff score    65.6701 does better against group IL_87907.2 cutoff score    84.4250; CAG*CAG
Sequence  282 in group IL_10167.6 with cutoff score    93.2203 does better against group IL_44465.1 cutoff score    95.5204; GGC*GGC
Sequence  284 in group IL_10167.6 with cutoff score    93.2203 does better against group IL_44465.1 cutoff score    95.5204; GGC*GGC
Sequence  286 in group IL_10167.6 with cutoff score    68.1189 does better against group IL_14688.1 cutoff score    72.5965; AGU*AAU
Sequence  286 in group IL_10167.6 with cutoff score    68.1189 does better against group IL_44465.1 cutoff score    85.0565; AGU*AAU
Sequence  286 in group IL_10167.6 with cutoff score    68.1189 does better against group IL_57744.1 cutoff score    80.9732; AGU*AAU
Sequence  286 in group IL_10167.6 with cutoff score    68.1189 does better against group IL_87907.2 cutoff score    78.1246; AGU*AAU
Sequence  288 in group IL_10167.6 with cutoff score    60.7533 does better against group IL_10167.6 cutoff score    67.1398; CAG*UGG
Sequence  288 in group IL_10167.6 with cutoff score    60.7533 does better against group IL_14688.1 cutoff score    64.7706; CAG*UGG
Sequence  288 in group IL_10167.6 with cutoff score    60.7533 does better against group IL_44465.1 cutoff score    82.7434; CAG*UGG
Sequence  288 in group IL_10167.6 with cutoff score    60.7533 does better against group IL_57744.1 cutoff score    62.8825; CAG*UGG
Sequence  288 in group IL_10167.6 with cutoff score    60.7533 does better against group IL_85599.2 cutoff score    71.6732; CAG*UGG
Sequence  288 in group IL_10167.6 with cutoff score    60.7533 does better against group IL_87907.2 cutoff score    61.6294; CAG*UGG
Sequence  289 in group IL_10167.6 with cutoff score    92.2429 does better against group IL_44465.1 cutoff score    98.5528; UGC*GGA
Sequence  290 in group IL_10167.6 with cutoff score    72.7630 does better against group IL_44465.1 cutoff score    86.9095; GGA*UAC
Sequence  290 in group IL_10167.6 with cutoff score    72.7630 does better against group IL_57744.1 cutoff score    85.9302; GGA*UAC
Sequence  290 in group IL_10167.6 with cutoff score    72.7630 does better against group IL_87907.2 cutoff score    79.0357; GGA*UAC
Sequence  291 in group IL_10167.6 with cutoff score    72.7630 does better against group IL_44465.1 cutoff score    86.9095; GGA*UAC
Sequence  291 in group IL_10167.6 with cutoff score    72.7630 does better against group IL_57744.1 cutoff score    85.9302; GGA*UAC
Sequence  291 in group IL_10167.6 with cutoff score    72.7630 does better against group IL_87907.2 cutoff score    79.0357; GGA*UAC
Sequence  292 in group IL_10167.6 with cutoff score    92.2429 does better against group IL_44465.1 cutoff score    98.5528; UGC*GGA
Sequence  293 in group IL_10167.6 with cutoff score    94.9342 does better against group IL_10167.6 cutoff score    95.1559; UGG*CGA
Sequence  293 in group IL_10167.6 with cutoff score    94.9342 does better against group IL_44465.1 cutoff score    98.6199; UGG*CGA
Sequence  294 in group IL_10167.6 with cutoff score    92.2429 does better against group IL_44465.1 cutoff score    98.5528; UGC*GGA
Sequence  295 in group IL_10167.6 with cutoff score    57.2599 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence  295 in group IL_10167.6 with cutoff score    57.2599 does better against group IL_08770.1 cutoff score    57.9851; GUC*GUC
Sequence  295 in group IL_10167.6 with cutoff score    57.2599 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence  295 in group IL_10167.6 with cutoff score    57.2599 does better against group IL_31737.3 cutoff score    80.1276; GUC*GUC
Sequence  295 in group IL_10167.6 with cutoff score    57.2599 does better against group IL_42771.1 cutoff score    92.4224; GUC*GUC
Sequence  295 in group IL_10167.6 with cutoff score    57.2599 does better against group IL_42997.3 cutoff score    77.7292; GUC*GUC
Sequence  295 in group IL_10167.6 with cutoff score    57.2599 does better against group IL_44465.1 cutoff score    61.8263; GUC*GUC
Sequence  295 in group IL_10167.6 with cutoff score    57.2599 does better against group IL_87907.2 cutoff score    96.0126; GUC*GUC
Sequence  296 in group IL_10167.6 with cutoff score    73.6577 does better against group IL_44465.1 cutoff score    75.0290; UGG*UGG
Sequence  297 in group IL_10167.6 with cutoff score    73.6577 does better against group IL_44465.1 cutoff score    75.0290; UGG*UGG
Sequence  298 in group IL_10167.6 has cutoff score    -0.0000; GUUU*GAC
Sequence  298 in group IL_10167.6 with cutoff score    -0.0000 does better against group IL_08770.1 cutoff score    18.1701; GUUU*GAC
Sequence  298 in group IL_10167.6 with cutoff score    -0.0000 does better against group IL_31737.3 cutoff score    24.2732; GUUU*GAC
Sequence  298 in group IL_10167.6 with cutoff score    -0.0000 does better against group IL_41344.1 cutoff score    12.0272; GUUU*GAC
Sequence  298 in group IL_10167.6 with cutoff score    -0.0000 does better against group IL_51387.2 cutoff score    20.4639; GUUU*GAC
Sequence  298 in group IL_10167.6 with cutoff score    -0.0000 does better against group IL_57744.1 cutoff score    55.6898; GUUU*GAC
Sequence  298 in group IL_10167.6 with cutoff score    -0.0000 does better against group IL_78800.1 cutoff score     4.1195; GUUU*GAC
Sequence  298 in group IL_10167.6 with cutoff score    -0.0000 does better against group IL_83389.2 cutoff score    44.1576; GUUU*GAC
Sequence  298 in group IL_10167.6 with cutoff score    -0.0000 does better against group IL_92446.2 cutoff score     7.6499; GUUU*GAC
Sequence  298 in group IL_10167.6 with cutoff score    -0.0000 does better against group IL_99358.1 cutoff score     7.5186; GUUU*GAC
Sequence  299 in group IL_10167.6 with cutoff score    52.6780 does better against group IL_07785.1 cutoff score    90.1097; CUU*ACG
Sequence  299 in group IL_10167.6 with cutoff score    52.6780 does better against group IL_08770.1 cutoff score    96.9975; CUU*ACG
Sequence  299 in group IL_10167.6 with cutoff score    52.6780 does better against group IL_14688.1 cutoff score    98.8874; CUU*ACG
Sequence  299 in group IL_10167.6 with cutoff score    52.6780 does better against group IL_28037.2 cutoff score    62.4160; CUU*ACG
Sequence  299 in group IL_10167.6 with cutoff score    52.6780 does better against group IL_87907.2 cutoff score    83.4058; CUU*ACG
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_08770.1 cutoff score    57.7314; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_14688.1 cutoff score    37.6147; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_15698.3 cutoff score    40.8997; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_31531.3 cutoff score    27.3141; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_31737.3 cutoff score    42.7729; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_41344.1 cutoff score    66.5723; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_42997.3 cutoff score    16.8905; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_47972.1 cutoff score    35.1980; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_55516.2 cutoff score    54.5233; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_57744.1 cutoff score    49.4316; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_57881.1 cutoff score    10.7405; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_61476.2 cutoff score    15.5614; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_67095.2 cutoff score     9.3848; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_82107.4 cutoff score    20.7572; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_83389.2 cutoff score    66.1486; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_90351.1 cutoff score    49.7623; GAU*AAUC
Sequence  300 in group IL_10167.6 with cutoff score     6.6198 does better against group IL_99358.1 cutoff score    69.5252; GAU*AAUC
Sequence  301 in group IL_10167.6 with cutoff score    73.6577 does better against group IL_44465.1 cutoff score    75.0290; UGG*UGG
Sequence  302 in group IL_10167.6 with cutoff score    53.8834 does better against group IL_14688.1 cutoff score    62.2262; CAG*UAG
Sequence  302 in group IL_10167.6 with cutoff score    53.8834 does better against group IL_31737.3 cutoff score    85.8607; CAG*UAG
Sequence  302 in group IL_10167.6 with cutoff score    53.8834 does better against group IL_42997.3 cutoff score    68.7028; CAG*UAG
Sequence  302 in group IL_10167.6 with cutoff score    53.8834 does better against group IL_57744.1 cutoff score    69.6037; CAG*UAG
Sequence  302 in group IL_10167.6 with cutoff score    53.8834 does better against group IL_87907.2 cutoff score    57.5570; CAG*UAG
Sequence  307 in group IL_10569.1 with cutoff score    97.0240 does better against group IL_42771.1 cutoff score    99.4164; AAA*UU
Sequence  314 in group IL_11399.2 with cutoff score    75.9745 does better against group IL_51479.1 cutoff score   100.0000; AAAAG*CGCU
Sequence  314 in group IL_11399.2 with cutoff score    75.9745 does better against group IL_62012.1 cutoff score   100.0000; AAAAG*CGCU
Sequence  314 in group IL_11399.2 with cutoff score    75.9745 does better against group IL_64231.5 cutoff score    95.8123; AAAAG*CGCU
Sequence  344 in group IL_14368.1 with cutoff score    26.2531 does better against group IL_20031.1 cutoff score    33.5652; GAGCA*UU
Sequence  348 in group IL_14688.1 with cutoff score    99.2022 does better against group IL_14688.1 cutoff score   100.0000; ACC*GUU
Sequence  353 in group IL_15052.4 with cutoff score    69.2057 does better against group IL_95583.2 cutoff score    72.1012; CCAGC*GG
Sequence  356 in group IL_15052.4 with cutoff score    97.2416 does better against group IL_73452.2 cutoff score   100.0000; GUAG*CC
Sequence  357 in group IL_15052.4 with cutoff score    97.2416 does better against group IL_73452.2 cutoff score   100.0000; GUAG*CC
Sequence  366 in group IL_15698.3 with cutoff score    83.9211 does better against group IL_57744.1 cutoff score    91.4917; GAUA*UGC
Sequence  367 in group IL_15698.3 with cutoff score    69.8955 does better against group IL_57744.1 cutoff score    78.7811; CAUG*UGG
Sequence  368 in group IL_15698.3 with cutoff score    83.9211 does better against group IL_57744.1 cutoff score    91.4917; GAUA*UGC
Sequence  369 in group IL_15698.3 with cutoff score    31.9889 does better against group IL_33323.1 cutoff score    42.4011; GAACAA*UAC
Sequence  369 in group IL_15698.3 with cutoff score    31.9889 does better against group IL_55516.2 cutoff score    56.7343; GAACAA*UAC
Sequence  369 in group IL_15698.3 with cutoff score    31.9889 does better against group IL_59302.1 cutoff score    63.3730; GAACAA*UAC
Sequence  369 in group IL_15698.3 with cutoff score    31.9889 does better against group IL_98347.1 cutoff score    67.0909; GAACAA*UAC
Sequence  370 in group IL_15698.3 with cutoff score    69.8955 does better against group IL_57744.1 cutoff score    78.7811; CAUG*UGG
Sequence  390 in group IL_17136.7 with cutoff score    93.6252 does better against group IL_38862.4 cutoff score    93.7109; CGAAG*CGUAG
Sequence  391 in group IL_17136.7 with cutoff score    93.6252 does better against group IL_38862.4 cutoff score    93.7109; CGAAG*CGUAG
Sequence  392 in group IL_17136.7 with cutoff score    84.2830 does better against group IL_38862.4 cutoff score    92.8394; CAAAC*GGUAG
Sequence  393 in group IL_17136.7 with cutoff score    84.2830 does better against group IL_38862.4 cutoff score    92.8394; CAAAC*GGUAG
Sequence  396 in group IL_17136.7 with cutoff score    85.5836 does better against group IL_38862.4 cutoff score    91.2940; UGAGG*UGUAG
Sequence  417 in group IL_17948.2 with cutoff score     0.6993 does better against group IL_82292.1 cutoff score    30.1636; ACUUC*GUUUGU
Sequence  417 in group IL_17948.2 with cutoff score     0.6993 does better against group IL_99498.1 cutoff score    19.1730; ACUUC*GUUUGU
Sequence  466 in group IL_22551.4 with cutoff score    69.3746 does better against group IL_56987.1 cutoff score   100.0000; GUUA*UC
Sequence  466 in group IL_22551.4 with cutoff score    69.3746 does better against group IL_66635.5 cutoff score    90.0782; GUUA*UC
Sequence  466 in group IL_22551.4 with cutoff score    69.3746 does better against group IL_82107.4 cutoff score    74.2938; GUUA*UC
Sequence  466 in group IL_22551.4 with cutoff score    69.3746 does better against group IL_84476.1 cutoff score    95.9380; GUUA*UC
Sequence  467 in group IL_22551.4 with cutoff score    37.5861 does better against group IL_20031.1 cutoff score    56.0590; AUCUG*CU
Sequence  467 in group IL_22551.4 with cutoff score    37.5861 does better against group IL_66635.5 cutoff score    39.4048; AUCUG*CU
Sequence  467 in group IL_22551.4 with cutoff score    37.5861 does better against group IL_94967.1 cutoff score    55.1994; AUCUG*CU
Sequence  483 in group IL_23774.1 with cutoff score    96.9191 does better against group IL_31558.1 cutoff score    99.3086; AGAAG*UGGU
Sequence  508 in group IL_25872.4 with cutoff score    99.1589 does better against group IL_58112.2 cutoff score   100.0000; GGGC*GGUAC
Sequence  509 in group IL_25872.4 with cutoff score    99.1589 does better against group IL_58112.2 cutoff score   100.0000; GGGC*GGUAC
Sequence  537 in group IL_26793.1 with cutoff score    79.9462 does better against group IL_33761.2 cutoff score    82.0866; CUG*CG
Sequence  537 in group IL_26793.1 with cutoff score    79.9462 does better against group IL_51454.3 cutoff score    87.1446; CUG*CG
Sequence  537 in group IL_26793.1 with cutoff score    79.9462 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence  537 in group IL_26793.1 with cutoff score    79.9462 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence  537 in group IL_26793.1 with cutoff score    79.9462 does better against group IL_89505.4 cutoff score    88.9804; CUG*CG
Sequence  537 in group IL_26793.1 with cutoff score    79.9462 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence  538 in group IL_26793.1 with cutoff score    99.9547 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  539 in group IL_26793.1 with cutoff score    96.1735 does better against group IL_10569.1 cutoff score    96.4413; GAA*UC
Sequence  539 in group IL_26793.1 with cutoff score    96.1735 does better against group IL_42771.1 cutoff score    98.8694; GAA*UC
Sequence  539 in group IL_26793.1 with cutoff score    96.1735 does better against group IL_90729.1 cutoff score    96.3805; GAA*UC
Sequence  540 in group IL_26793.1 with cutoff score    91.6183 does better against group IL_61258.15 cutoff score    92.3218; CCU*AG
Sequence  540 in group IL_26793.1 with cutoff score    91.6183 does better against group IL_63775.1 cutoff score    98.9913; CCU*AG
Sequence  543 in group IL_26793.1 with cutoff score    91.6183 does better against group IL_61258.15 cutoff score    92.3218; CCU*AG
Sequence  543 in group IL_26793.1 with cutoff score    91.6183 does better against group IL_63775.1 cutoff score    98.9913; CCU*AG
Sequence  544 in group IL_26793.1 with cutoff score    91.6183 does better against group IL_61258.15 cutoff score    92.3218; CCU*AG
Sequence  544 in group IL_26793.1 with cutoff score    91.6183 does better against group IL_63775.1 cutoff score    98.9913; CCU*AG
Sequence  545 in group IL_26793.1 with cutoff score    91.6183 does better against group IL_61258.15 cutoff score    92.3218; CCU*AG
Sequence  545 in group IL_26793.1 with cutoff score    91.6183 does better against group IL_63775.1 cutoff score    98.9913; CCU*AG
Sequence  546 in group IL_26793.1 with cutoff score    99.9547 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  549 in group IL_26793.1 with cutoff score    91.1435 does better against group IL_61258.15 cutoff score    91.3710; ACU*AU
Sequence  551 in group IL_26793.1 with cutoff score    99.9547 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  560 in group IL_28037.2 with cutoff score    98.1434 does better against group IL_07785.1 cutoff score    99.9471; AUC*GUU
Sequence  564 in group IL_28037.2 with cutoff score    98.1434 does better against group IL_07785.1 cutoff score    99.9471; AUC*GUU
Sequence  568 in group IL_28037.2 with cutoff score    98.1434 does better against group IL_07785.1 cutoff score    99.9471; AUC*GUU
Sequence  570 in group IL_28037.2 with cutoff score    98.1434 does better against group IL_07785.1 cutoff score    99.9471; AUC*GUU
Sequence  571 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_07785.1 cutoff score   100.0000; CUG*CUG
Sequence  571 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_42771.1 cutoff score    94.2244; CUG*CUG
Sequence  571 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_87907.2 cutoff score   100.0000; CUG*CUG
Sequence  572 in group IL_28037.2 with cutoff score    93.7987 does better against group IL_07785.1 cutoff score    99.9607; AUG*CUU
Sequence  574 in group IL_28037.2 with cutoff score    91.2861 does better against group IL_07785.1 cutoff score    99.6185; UUC*GUA
Sequence  574 in group IL_28037.2 with cutoff score    91.2861 does better against group IL_28037.2 cutoff score    91.7444; UUC*GUA
Sequence  574 in group IL_28037.2 with cutoff score    91.2861 does better against group IL_42771.1 cutoff score    95.1150; UUC*GUA
Sequence  575 in group IL_28037.2 with cutoff score    66.7607 does better against group IL_07785.1 cutoff score    89.1202; ACC*GUU
Sequence  575 in group IL_28037.2 with cutoff score    66.7607 does better against group IL_08770.1 cutoff score    94.8973; ACC*GUU
Sequence  575 in group IL_28037.2 with cutoff score    66.7607 does better against group IL_14688.1 cutoff score   100.0000; ACC*GUU
Sequence  575 in group IL_28037.2 with cutoff score    66.7607 does better against group IL_87907.2 cutoff score    80.9028; ACC*GUU
Sequence  578 in group IL_28037.2 with cutoff score    93.7987 does better against group IL_07785.1 cutoff score    99.9607; AUG*CUU
Sequence  579 in group IL_28037.2 with cutoff score    89.7563 does better against group IL_07785.1 cutoff score    97.0935; AUU*AUU
Sequence  579 in group IL_28037.2 with cutoff score    89.7563 does better against group IL_42771.1 cutoff score    93.0142; AUU*AUU
Sequence  581 in group IL_28037.2 with cutoff score    89.7563 does better against group IL_07785.1 cutoff score    97.0935; AUU*AUU
Sequence  581 in group IL_28037.2 with cutoff score    89.7563 does better against group IL_42771.1 cutoff score    93.0142; AUU*AUU
Sequence  585 in group IL_28037.2 with cutoff score    95.6553 does better against group IL_07785.1 cutoff score   100.0000; GUG*CUC
Sequence  585 in group IL_28037.2 with cutoff score    95.6553 does better against group IL_87907.2 cutoff score    98.5156; GUG*CUC
Sequence  586 in group IL_28037.2 with cutoff score    94.6008 does better against group IL_07785.1 cutoff score   100.0000; CUC*GUG
Sequence  586 in group IL_28037.2 with cutoff score    94.6008 does better against group IL_28037.2 cutoff score    95.6553; CUC*GUG
Sequence  586 in group IL_28037.2 with cutoff score    94.6008 does better against group IL_87907.2 cutoff score    98.5156; CUC*GUG
Sequence  587 in group IL_28037.2 with cutoff score    89.8878 does better against group IL_07785.1 cutoff score    97.6721; AUA*UUU
Sequence  587 in group IL_28037.2 with cutoff score    89.8878 does better against group IL_42771.1 cutoff score    95.6619; AUA*UUU
Sequence  588 in group IL_28037.2 with cutoff score    95.6553 does better against group IL_07785.1 cutoff score   100.0000; GUG*CUC
Sequence  588 in group IL_28037.2 with cutoff score    95.6553 does better against group IL_87907.2 cutoff score    98.5156; GUG*CUC
Sequence  589 in group IL_28037.2 with cutoff score    58.3736 does better against group IL_07785.1 cutoff score    89.0808; ACU*AUU
Sequence  589 in group IL_28037.2 with cutoff score    58.3736 does better against group IL_08770.1 cutoff score    94.7363; ACU*AUU
Sequence  589 in group IL_28037.2 with cutoff score    58.3736 does better against group IL_14688.1 cutoff score    99.4942; ACU*AUU
Sequence  589 in group IL_28037.2 with cutoff score    58.3736 does better against group IL_87907.2 cutoff score    75.7006; ACU*AUU
Sequence  590 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_07785.1 cutoff score   100.0000; CUG*CUG
Sequence  590 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_42771.1 cutoff score    94.2244; CUG*CUG
Sequence  590 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_87907.2 cutoff score   100.0000; CUG*CUG
Sequence  592 in group IL_28037.2 with cutoff score    89.8878 does better against group IL_07785.1 cutoff score    97.6721; AUA*UUU
Sequence  592 in group IL_28037.2 with cutoff score    89.8878 does better against group IL_42771.1 cutoff score    95.6619; AUA*UUU
Sequence  595 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_07785.1 cutoff score   100.0000; CUG*CUG
Sequence  595 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_42771.1 cutoff score    94.2244; CUG*CUG
Sequence  595 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_87907.2 cutoff score   100.0000; CUG*CUG
Sequence  598 in group IL_28037.2 with cutoff score    55.5201 does better against group IL_07785.1 cutoff score    80.3599; CCG*CCG
Sequence  598 in group IL_28037.2 with cutoff score    55.5201 does better against group IL_10796.1 cutoff score    56.1182; CCG*CCG
Sequence  598 in group IL_28037.2 with cutoff score    55.5201 does better against group IL_31737.3 cutoff score    70.7312; CCG*CCG
Sequence  598 in group IL_28037.2 with cutoff score    55.5201 does better against group IL_87907.2 cutoff score    93.1131; CCG*CCG
Sequence  599 in group IL_28037.2 with cutoff score    91.7444 does better against group IL_07785.1 cutoff score    99.6185; GUA*UUC
Sequence  599 in group IL_28037.2 with cutoff score    91.7444 does better against group IL_42771.1 cutoff score    95.1150; GUA*UUC
Sequence  600 in group IL_28037.2 with cutoff score    95.6553 does better against group IL_07785.1 cutoff score   100.0000; GUG*CUC
Sequence  600 in group IL_28037.2 with cutoff score    95.6553 does better against group IL_87907.2 cutoff score    98.5156; GUG*CUC
Sequence  601 in group IL_28037.2 with cutoff score    93.7987 does better against group IL_07785.1 cutoff score    99.9607; AUG*CUU
Sequence  602 in group IL_28037.2 with cutoff score    93.7987 does better against group IL_07785.1 cutoff score    99.9607; AUG*CUU
Sequence  603 in group IL_28037.2 with cutoff score    56.1780 does better against group IL_07785.1 cutoff score    89.0808; AUU*ACU
Sequence  603 in group IL_28037.2 with cutoff score    56.1780 does better against group IL_08770.1 cutoff score    94.7363; AUU*ACU
Sequence  603 in group IL_28037.2 with cutoff score    56.1780 does better against group IL_14688.1 cutoff score    99.4942; AUU*ACU
Sequence  603 in group IL_28037.2 with cutoff score    56.1780 does better against group IL_28037.2 cutoff score    58.3736; AUU*ACU
Sequence  603 in group IL_28037.2 with cutoff score    56.1780 does better against group IL_87907.2 cutoff score    75.7006; AUU*ACU
Sequence  604 in group IL_28037.2 with cutoff score    89.8878 does better against group IL_07785.1 cutoff score    97.6721; AUA*UUU
Sequence  604 in group IL_28037.2 with cutoff score    89.8878 does better against group IL_42771.1 cutoff score    95.6619; AUA*UUU
Sequence  607 in group IL_28037.2 with cutoff score    83.0305 does better against group IL_07785.1 cutoff score    97.3435; UUA*UUA
Sequence  607 in group IL_28037.2 with cutoff score    83.0305 does better against group IL_42771.1 cutoff score    96.7724; UUA*UUA
Sequence  608 in group IL_28037.2 with cutoff score    76.9984 does better against group IL_07785.1 cutoff score    99.2040; CUG*UUG
Sequence  608 in group IL_28037.2 with cutoff score    76.9984 does better against group IL_42771.1 cutoff score    78.9378; CUG*UUG
Sequence  609 in group IL_28037.2 with cutoff score    80.5410 does better against group IL_07785.1 cutoff score    96.3369; AUG*UUU
Sequence  611 in group IL_28037.2 with cutoff score    76.9984 does better against group IL_07785.1 cutoff score    99.2040; CUG*UUG
Sequence  611 in group IL_28037.2 with cutoff score    76.9984 does better against group IL_42771.1 cutoff score    78.9378; CUG*UUG
Sequence  612 in group IL_28037.2 with cutoff score    93.7987 does better against group IL_07785.1 cutoff score    99.9607; AUG*CUU
Sequence  614 in group IL_28037.2 with cutoff score    93.7987 does better against group IL_07785.1 cutoff score    99.9607; AUG*CUU
Sequence  615 in group IL_28037.2 with cutoff score    76.9984 does better against group IL_07785.1 cutoff score    99.2040; CUG*UUG
Sequence  615 in group IL_28037.2 with cutoff score    76.9984 does better against group IL_42771.1 cutoff score    78.9378; CUG*UUG
Sequence  616 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_07785.1 cutoff score   100.0000; CUG*CUG
Sequence  616 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_42771.1 cutoff score    94.2244; CUG*CUG
Sequence  616 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_87907.2 cutoff score   100.0000; CUG*CUG
Sequence  617 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_07785.1 cutoff score   100.0000; CUG*CUG
Sequence  617 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_42771.1 cutoff score    94.2244; CUG*CUG
Sequence  617 in group IL_28037.2 with cutoff score    90.2561 does better against group IL_87907.2 cutoff score   100.0000; CUG*CUG
Sequence  618 in group IL_28037.2 with cutoff score    80.5410 does better against group IL_07785.1 cutoff score    96.3369; AUG*UUU
Sequence  619 in group IL_28037.2 with cutoff score    93.7987 does better against group IL_07785.1 cutoff score    99.9607; AUG*CUU
Sequence  620 in group IL_28037.2 with cutoff score    98.1434 does better against group IL_07785.1 cutoff score    99.9471; AUC*GUU
Sequence  621 in group IL_28037.2 with cutoff score    64.9389 does better against group IL_07785.1 cutoff score    96.3369; UUU*AUG
Sequence  621 in group IL_28037.2 with cutoff score    64.9389 does better against group IL_28037.2 cutoff score    80.5410; UUU*AUG
Sequence  621 in group IL_28037.2 with cutoff score    64.9389 does better against group IL_42771.1 cutoff score    78.3542; UUU*AUG
Sequence  621 in group IL_28037.2 with cutoff score    64.9389 does better against group IL_87907.2 cutoff score    66.4787; UUU*AUG
Sequence  641 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  641 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_26793.1 cutoff score    99.9547; AAG*CU
Sequence  641 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_42771.1 cutoff score    97.3953; AAG*CU
Sequence  641 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_90729.1 cutoff score    96.0385; AAG*CU
Sequence  642 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  643 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  643 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_26793.1 cutoff score    99.9547; AAG*CU
Sequence  643 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_42771.1 cutoff score    97.3953; AAG*CU
Sequence  643 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_90729.1 cutoff score    96.0385; AAG*CU
Sequence  644 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_10569.1 cutoff score    96.3788; UAA*UA
Sequence  644 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_26793.1 cutoff score    95.6726; UAA*UA
Sequence  644 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_31737.3 cutoff score    82.4226; UAA*UA
Sequence  644 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_33761.2 cutoff score    87.2944; UAA*UA
Sequence  644 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_42771.1 cutoff score   100.0000; UAA*UA
Sequence  644 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_48076.6 cutoff score    90.4088; UAA*UA
Sequence  644 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_66635.5 cutoff score    84.5716; UAA*UA
Sequence  644 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_90729.1 cutoff score    90.0436; UAA*UA
Sequence  645 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  647 in group IL_31462.6 with cutoff score    76.2985 does better against group IL_33761.2 cutoff score    78.8557; GAC*GU
Sequence  648 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_10569.1 cutoff score    96.3788; UAA*UA
Sequence  648 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_26793.1 cutoff score    95.6726; UAA*UA
Sequence  648 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_31737.3 cutoff score    82.4226; UAA*UA
Sequence  648 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_33761.2 cutoff score    87.2944; UAA*UA
Sequence  648 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_42771.1 cutoff score   100.0000; UAA*UA
Sequence  648 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_48076.6 cutoff score    90.4088; UAA*UA
Sequence  648 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_66635.5 cutoff score    84.5716; UAA*UA
Sequence  648 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_90729.1 cutoff score    90.0436; UAA*UA
Sequence  649 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  649 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  649 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  649 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  649 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  650 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  651 in group IL_31462.6 with cutoff score    84.0649 does better against group IL_26793.1 cutoff score    97.4944; UAU*AA
Sequence  651 in group IL_31462.6 with cutoff score    84.0649 does better against group IL_33761.2 cutoff score    87.4300; UAU*AA
Sequence  651 in group IL_31462.6 with cutoff score    84.0649 does better against group IL_42771.1 cutoff score    97.8792; UAU*AA
Sequence  651 in group IL_31462.6 with cutoff score    84.0649 does better against group IL_66635.5 cutoff score    84.0891; UAU*AA
Sequence  651 in group IL_31462.6 with cutoff score    84.0649 does better against group IL_90729.1 cutoff score    88.2787; UAU*AA
Sequence  652 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_26793.1 cutoff score    95.2028; UAC*GA
Sequence  652 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_33761.2 cutoff score   100.0000; UAC*GA
Sequence  652 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_42771.1 cutoff score    97.8344; UAC*GA
Sequence  652 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_48076.6 cutoff score    94.4141; UAC*GA
Sequence  653 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_07039.3 cutoff score    96.4006; UAG*CG
Sequence  653 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_66635.5 cutoff score    89.7621; UAG*CG
Sequence  654 in group IL_31462.6 with cutoff score    76.2985 does better against group IL_33761.2 cutoff score    78.8557; GAC*GU
Sequence  655 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_26793.1 cutoff score    95.2028; UAC*GA
Sequence  655 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_33761.2 cutoff score   100.0000; UAC*GA
Sequence  655 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_42771.1 cutoff score    97.8344; UAC*GA
Sequence  655 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_48076.6 cutoff score    94.4141; UAC*GA
Sequence  656 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_26793.1 cutoff score    95.2028; UAC*GA
Sequence  656 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_33761.2 cutoff score   100.0000; UAC*GA
Sequence  656 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_42771.1 cutoff score    97.8344; UAC*GA
Sequence  656 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_48076.6 cutoff score    94.4141; UAC*GA
Sequence  657 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_26793.1 cutoff score    95.2028; UAC*GA
Sequence  657 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_33761.2 cutoff score   100.0000; UAC*GA
Sequence  657 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_42771.1 cutoff score    97.8344; UAC*GA
Sequence  657 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_48076.6 cutoff score    94.4141; UAC*GA
Sequence  658 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  658 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_26793.1 cutoff score    99.9547; AAG*CU
Sequence  658 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_42771.1 cutoff score    97.3953; AAG*CU
Sequence  658 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_90729.1 cutoff score    96.0385; AAG*CU
Sequence  659 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_07039.3 cutoff score    93.4870; UAC*GG
Sequence  659 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence  659 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_48076.6 cutoff score    96.2696; UAC*GG
Sequence  659 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_66635.5 cutoff score    89.0823; UAC*GG
Sequence  660 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  660 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_26793.1 cutoff score    99.9547; AAG*CU
Sequence  660 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_42771.1 cutoff score    97.3953; AAG*CU
Sequence  660 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_90729.1 cutoff score    96.0385; AAG*CU
Sequence  661 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_26793.1 cutoff score    95.2028; UAC*GA
Sequence  661 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_33761.2 cutoff score   100.0000; UAC*GA
Sequence  661 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_42771.1 cutoff score    97.8344; UAC*GA
Sequence  661 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_48076.6 cutoff score    94.4141; UAC*GA
Sequence  663 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  663 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  663 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  663 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  663 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  664 in group IL_31462.6 with cutoff score    77.1887 does better against group IL_07039.3 cutoff score    94.3443; UAA*UG
Sequence  664 in group IL_31462.6 with cutoff score    77.1887 does better against group IL_33761.2 cutoff score    85.5044; UAA*UG
Sequence  664 in group IL_31462.6 with cutoff score    77.1887 does better against group IL_42771.1 cutoff score    81.8923; UAA*UG
Sequence  664 in group IL_31462.6 with cutoff score    77.1887 does better against group IL_48076.6 cutoff score    92.2642; UAA*UG
Sequence  664 in group IL_31462.6 with cutoff score    77.1887 does better against group IL_66635.5 cutoff score    86.2090; UAA*UG
Sequence  665 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_26793.1 cutoff score    98.4249; CAU*AG
Sequence  665 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_42771.1 cutoff score    97.3523; CAU*AG
Sequence  665 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_51454.3 cutoff score    96.9432; CAU*AG
Sequence  665 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_90729.1 cutoff score    91.9307; CAU*AG
Sequence  666 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_26793.1 cutoff score    98.4249; CAU*AG
Sequence  666 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_42771.1 cutoff score    97.3523; CAU*AG
Sequence  666 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_51454.3 cutoff score    96.9432; CAU*AG
Sequence  666 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_90729.1 cutoff score    91.9307; CAU*AG
Sequence  668 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  668 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_26793.1 cutoff score    99.9547; AAG*CU
Sequence  668 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_42771.1 cutoff score    97.3953; AAG*CU
Sequence  668 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_90729.1 cutoff score    96.0385; AAG*CU
Sequence  669 in group IL_31462.6 with cutoff score    64.4229 does better against group IL_07039.3 cutoff score    69.9026; CAG*UG
Sequence  669 in group IL_31462.6 with cutoff score    64.4229 does better against group IL_10569.1 cutoff score    79.4465; CAG*UG
Sequence  669 in group IL_31462.6 with cutoff score    64.4229 does better against group IL_26793.1 cutoff score    75.1234; CAG*UG
Sequence  669 in group IL_31462.6 with cutoff score    64.4229 does better against group IL_31737.3 cutoff score    72.1998; CAG*UG
Sequence  669 in group IL_31462.6 with cutoff score    64.4229 does better against group IL_33761.2 cutoff score    64.7479; CAG*UG
Sequence  669 in group IL_31462.6 with cutoff score    64.4229 does better against group IL_42771.1 cutoff score    82.6923; CAG*UG
Sequence  669 in group IL_31462.6 with cutoff score    64.4229 does better against group IL_48076.6 cutoff score    64.6603; CAG*UG
Sequence  669 in group IL_31462.6 with cutoff score    64.4229 does better against group IL_51454.3 cutoff score    71.5546; CAG*UG
Sequence  669 in group IL_31462.6 with cutoff score    64.4229 does better against group IL_90729.1 cutoff score    71.3618; CAG*UG
Sequence  670 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  672 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  673 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  673 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  673 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  673 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  673 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  674 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  675 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  675 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  675 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  675 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  675 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  676 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_10569.1 cutoff score    96.3788; UAA*UA
Sequence  676 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_26793.1 cutoff score    95.6726; UAA*UA
Sequence  676 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_31737.3 cutoff score    82.4226; UAA*UA
Sequence  676 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_33761.2 cutoff score    87.2944; UAA*UA
Sequence  676 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_42771.1 cutoff score   100.0000; UAA*UA
Sequence  676 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_48076.6 cutoff score    90.4088; UAA*UA
Sequence  676 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_66635.5 cutoff score    84.5716; UAA*UA
Sequence  676 in group IL_31462.6 with cutoff score    82.1447 does better against group IL_90729.1 cutoff score    90.0436; UAA*UA
Sequence  677 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  678 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_10569.1 cutoff score    96.4413; GAA*UC
Sequence  678 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_26793.1 cutoff score    96.1735; GAA*UC
Sequence  678 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_42771.1 cutoff score    98.8694; GAA*UC
Sequence  678 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_48076.6 cutoff score    91.7452; GAA*UC
Sequence  678 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_66635.5 cutoff score    90.2433; GAA*UC
Sequence  678 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_90729.1 cutoff score    96.3805; GAA*UC
Sequence  679 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  680 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  683 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_10569.1 cutoff score    96.4413; GAA*UC
Sequence  683 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_26793.1 cutoff score    96.1735; GAA*UC
Sequence  683 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_42771.1 cutoff score    98.8694; GAA*UC
Sequence  683 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_48076.6 cutoff score    91.7452; GAA*UC
Sequence  683 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_66635.5 cutoff score    90.2433; GAA*UC
Sequence  683 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_90729.1 cutoff score    96.3805; GAA*UC
Sequence  685 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_26793.1 cutoff score    97.9501; AAU*AU
Sequence  685 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_33761.2 cutoff score    86.3140; AAU*AU
Sequence  685 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_42771.1 cutoff score    96.7687; AAU*AU
Sequence  685 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_66635.5 cutoff score    85.1058; AAU*AU
Sequence  685 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_90729.1 cutoff score    90.6540; AAU*AU
Sequence  686 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  686 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  686 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  686 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  686 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  687 in group IL_31462.6 with cutoff score    79.9538 does better against group IL_10569.1 cutoff score    82.0301; GAG*CU
Sequence  688 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_26793.1 cutoff score    95.2028; UAC*GA
Sequence  688 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_33761.2 cutoff score   100.0000; UAC*GA
Sequence  688 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_42771.1 cutoff score    97.8344; UAC*GA
Sequence  688 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_48076.6 cutoff score    94.4141; UAC*GA
Sequence  689 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  689 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  689 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  689 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  689 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  690 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  690 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_26793.1 cutoff score    99.9547; AAG*CU
Sequence  690 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_42771.1 cutoff score    97.3953; AAG*CU
Sequence  690 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_90729.1 cutoff score    96.0385; AAG*CU
Sequence  691 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_26793.1 cutoff score    97.9954; GAU*AC
Sequence  691 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_42771.1 cutoff score    96.2217; GAU*AC
Sequence  691 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_90729.1 cutoff score    94.6156; GAU*AC
Sequence  692 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_26793.1 cutoff score    97.9954; GAU*AC
Sequence  692 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_42771.1 cutoff score    96.2217; GAU*AC
Sequence  692 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_90729.1 cutoff score    94.6156; GAU*AC
Sequence  693 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_26793.1 cutoff score    97.9501; AAU*AU
Sequence  693 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_33761.2 cutoff score    86.3140; AAU*AU
Sequence  693 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_42771.1 cutoff score    96.7687; AAU*AU
Sequence  693 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_66635.5 cutoff score    85.1058; AAU*AU
Sequence  693 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_90729.1 cutoff score    90.6540; AAU*AU
Sequence  694 in group IL_31462.6 with cutoff score    79.9538 does better against group IL_10569.1 cutoff score    82.0301; GAG*CU
Sequence  696 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_10569.1 cutoff score    99.3488; UAG*CA
Sequence  696 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_26793.1 cutoff score    99.4990; UAG*CA
Sequence  696 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_42771.1 cutoff score    98.5058; UAG*CA
Sequence  696 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_90729.1 cutoff score    93.6631; UAG*CA
Sequence  697 in group IL_31462.6 with cutoff score    73.4179 does better against group IL_26793.1 cutoff score    76.6286; GAU*GC
Sequence  697 in group IL_31462.6 with cutoff score    73.4179 does better against group IL_42771.1 cutoff score    73.6821; GAU*GC
Sequence  698 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_26793.1 cutoff score    97.9954; GAU*AC
Sequence  698 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_42771.1 cutoff score    96.2217; GAU*AC
Sequence  698 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_90729.1 cutoff score    94.6156; GAU*AC
Sequence  699 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  699 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  699 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  699 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  699 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  700 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  701 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_10569.1 cutoff score    96.4413; GAA*UC
Sequence  701 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_26793.1 cutoff score    96.1735; GAA*UC
Sequence  701 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_42771.1 cutoff score    98.8694; GAA*UC
Sequence  701 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_48076.6 cutoff score    91.7452; GAA*UC
Sequence  701 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_66635.5 cutoff score    90.2433; GAA*UC
Sequence  701 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_90729.1 cutoff score    96.3805; GAA*UC
Sequence  702 in group IL_31462.6 with cutoff score    88.0539 does better against group IL_26793.1 cutoff score    95.6585; AAC*GU
Sequence  702 in group IL_31462.6 with cutoff score    88.0539 does better against group IL_33761.2 cutoff score    98.9390; AAC*GU
Sequence  702 in group IL_31462.6 with cutoff score    88.0539 does better against group IL_42771.1 cutoff score    96.7239; AAC*GU
Sequence  702 in group IL_31462.6 with cutoff score    88.0539 does better against group IL_48076.6 cutoff score    92.3510; AAC*GU
Sequence  702 in group IL_31462.6 with cutoff score    88.0539 does better against group IL_66635.5 cutoff score    88.4616; AAC*GU
Sequence  702 in group IL_31462.6 with cutoff score    88.0539 does better against group IL_90729.1 cutoff score    90.2830; AAC*GU
Sequence  703 in group IL_31462.6 with cutoff score    73.4179 does better against group IL_26793.1 cutoff score    76.6286; GAU*GC
Sequence  703 in group IL_31462.6 with cutoff score    73.4179 does better against group IL_42771.1 cutoff score    73.6821; GAU*GC
Sequence  705 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  706 in group IL_31462.6 with cutoff score    73.4179 does better against group IL_26793.1 cutoff score    76.6286; GAU*GC
Sequence  706 in group IL_31462.6 with cutoff score    73.4179 does better against group IL_42771.1 cutoff score    73.6821; GAU*GC
Sequence  707 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  708 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_26793.1 cutoff score    97.9501; AAU*AU
Sequence  708 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_33761.2 cutoff score    86.3140; AAU*AU
Sequence  708 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_42771.1 cutoff score    96.7687; AAU*AU
Sequence  708 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_66635.5 cutoff score    85.1058; AAU*AU
Sequence  708 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_90729.1 cutoff score    90.6540; AAU*AU
Sequence  709 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  709 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  709 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  709 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  709 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  710 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_26793.1 cutoff score    97.9954; GAU*AC
Sequence  710 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_42771.1 cutoff score    96.2217; GAU*AC
Sequence  710 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_90729.1 cutoff score    94.6156; GAU*AC
Sequence  711 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_26793.1 cutoff score    96.1333; CAC*GG
Sequence  711 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_33761.2 cutoff score   100.0000; CAC*GG
Sequence  711 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_42771.1 cutoff score    97.3075; CAC*GG
Sequence  711 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_48076.6 cutoff score   100.0000; CAC*GG
Sequence  711 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_51454.3 cutoff score   100.0000; CAC*GG
Sequence  713 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_10569.1 cutoff score    96.4413; GAA*UC
Sequence  713 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_26793.1 cutoff score    96.1735; GAA*UC
Sequence  713 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_42771.1 cutoff score    98.8694; GAA*UC
Sequence  713 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_48076.6 cutoff score    91.7452; GAA*UC
Sequence  713 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_66635.5 cutoff score    90.2433; GAA*UC
Sequence  713 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_90729.1 cutoff score    96.3805; GAA*UC
Sequence  714 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_07039.3 cutoff score    96.4006; UAG*CG
Sequence  714 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_66635.5 cutoff score    89.7621; UAG*CG
Sequence  716 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  717 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_26793.1 cutoff score    97.9954; GAU*AC
Sequence  717 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_42771.1 cutoff score    96.2217; GAU*AC
Sequence  717 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_90729.1 cutoff score    94.6156; GAU*AC
Sequence  718 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_26793.1 cutoff score    96.1333; CAC*GG
Sequence  718 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_33761.2 cutoff score   100.0000; CAC*GG
Sequence  718 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_42771.1 cutoff score    97.3075; CAC*GG
Sequence  718 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_48076.6 cutoff score   100.0000; CAC*GG
Sequence  718 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_51454.3 cutoff score   100.0000; CAC*GG
Sequence  719 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  720 in group IL_31462.6 with cutoff score    76.2985 does better against group IL_33761.2 cutoff score    78.8557; GAC*GU
Sequence  721 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  721 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  721 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  721 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  721 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  722 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_26793.1 cutoff score    98.4249; CAU*AG
Sequence  722 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_42771.1 cutoff score    97.3523; CAU*AG
Sequence  722 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_51454.3 cutoff score    96.9432; CAU*AG
Sequence  722 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_90729.1 cutoff score    91.9307; CAU*AG
Sequence  723 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_07039.3 cutoff score    93.4870; UAC*GG
Sequence  723 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence  723 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_48076.6 cutoff score    96.2696; UAC*GG
Sequence  723 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_66635.5 cutoff score    89.0823; UAC*GG
Sequence  724 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_07039.3 cutoff score    96.4006; UAG*CG
Sequence  724 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_66635.5 cutoff score    89.7621; UAG*CG
Sequence  725 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_26793.1 cutoff score    97.9954; GAU*AC
Sequence  725 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_42771.1 cutoff score    96.2217; GAU*AC
Sequence  725 in group IL_31462.6 with cutoff score    91.2808 does better against group IL_90729.1 cutoff score    94.6156; GAU*AC
Sequence  726 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  726 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  726 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  726 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  726 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  728 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  728 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  728 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  728 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  728 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  731 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  732 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_10569.1 cutoff score    99.3488; UAG*CA
Sequence  732 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_26793.1 cutoff score    99.4990; UAG*CA
Sequence  732 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_42771.1 cutoff score    98.5058; UAG*CA
Sequence  732 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_90729.1 cutoff score    93.6631; UAG*CA
Sequence  733 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_26793.1 cutoff score    96.1333; CAC*GG
Sequence  733 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_33761.2 cutoff score   100.0000; CAC*GG
Sequence  733 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_42771.1 cutoff score    97.3075; CAC*GG
Sequence  733 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_48076.6 cutoff score   100.0000; CAC*GG
Sequence  733 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_51454.3 cutoff score   100.0000; CAC*GG
Sequence  734 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  734 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_26793.1 cutoff score    99.9547; AAG*CU
Sequence  734 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_42771.1 cutoff score    97.3953; AAG*CU
Sequence  734 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_90729.1 cutoff score    96.0385; AAG*CU
Sequence  735 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  735 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_26793.1 cutoff score    99.9547; AAG*CU
Sequence  735 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_42771.1 cutoff score    97.3953; AAG*CU
Sequence  735 in group IL_31462.6 with cutoff score    91.7092 does better against group IL_90729.1 cutoff score    96.0385; AAG*CU
Sequence  736 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_07039.3 cutoff score    96.4006; UAG*CG
Sequence  736 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_66635.5 cutoff score    89.7621; UAG*CG
Sequence  738 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_07039.3 cutoff score    96.4006; UAG*CG
Sequence  738 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_66635.5 cutoff score    89.7621; UAG*CG
Sequence  739 in group IL_31462.6 with cutoff score    84.0649 does better against group IL_26793.1 cutoff score    97.4944; UAU*AA
Sequence  739 in group IL_31462.6 with cutoff score    84.0649 does better against group IL_33761.2 cutoff score    87.4300; UAU*AA
Sequence  739 in group IL_31462.6 with cutoff score    84.0649 does better against group IL_42771.1 cutoff score    97.8792; UAU*AA
Sequence  739 in group IL_31462.6 with cutoff score    84.0649 does better against group IL_66635.5 cutoff score    84.0891; UAU*AA
Sequence  739 in group IL_31462.6 with cutoff score    84.0649 does better against group IL_90729.1 cutoff score    88.2787; UAU*AA
Sequence  740 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_07039.3 cutoff score    93.4870; UAC*GG
Sequence  740 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence  740 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_48076.6 cutoff score    96.2696; UAC*GG
Sequence  740 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_66635.5 cutoff score    89.0823; UAC*GG
Sequence  741 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_26793.1 cutoff score    97.9501; AAU*AU
Sequence  741 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_33761.2 cutoff score    86.3140; AAU*AU
Sequence  741 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_42771.1 cutoff score    96.7687; AAU*AU
Sequence  741 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_66635.5 cutoff score    85.1058; AAU*AU
Sequence  741 in group IL_31462.6 with cutoff score    82.9901 does better against group IL_90729.1 cutoff score    90.6540; AAU*AU
Sequence  743 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_10569.1 cutoff score    96.4413; GAA*UC
Sequence  743 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_26793.1 cutoff score    96.1735; GAA*UC
Sequence  743 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_42771.1 cutoff score    98.8694; GAA*UC
Sequence  743 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_48076.6 cutoff score    91.7452; GAA*UC
Sequence  743 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_66635.5 cutoff score    90.2433; GAA*UC
Sequence  743 in group IL_31462.6 with cutoff score    89.3606 does better against group IL_90729.1 cutoff score    96.3805; GAA*UC
Sequence  744 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  744 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  744 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  744 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  744 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  745 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_07039.3 cutoff score    96.4006; UAG*CG
Sequence  745 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_66635.5 cutoff score    89.7621; UAG*CG
Sequence  746 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  746 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  746 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  746 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  746 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  747 in group IL_31462.6 with cutoff score    85.6871 does better against group IL_10569.1 cutoff score    97.0299; CAA*UG
Sequence  747 in group IL_31462.6 with cutoff score    85.6871 does better against group IL_26793.1 cutoff score    96.6030; CAA*UG
Sequence  747 in group IL_31462.6 with cutoff score    85.6871 does better against group IL_33761.2 cutoff score    87.2393; CAA*UG
Sequence  747 in group IL_31462.6 with cutoff score    85.6871 does better against group IL_42771.1 cutoff score   100.0000; CAA*UG
Sequence  747 in group IL_31462.6 with cutoff score    85.6871 does better against group IL_48076.6 cutoff score    95.9947; CAA*UG
Sequence  747 in group IL_31462.6 with cutoff score    85.6871 does better against group IL_51454.3 cutoff score    95.0778; CAA*UG
Sequence  747 in group IL_31462.6 with cutoff score    85.6871 does better against group IL_66635.5 cutoff score    85.7234; CAA*UG
Sequence  747 in group IL_31462.6 with cutoff score    85.6871 does better against group IL_90729.1 cutoff score    93.6956; CAA*UG
Sequence  748 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  749 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_10569.1 cutoff score    99.3488; UAG*CA
Sequence  749 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_26793.1 cutoff score    99.4990; UAG*CA
Sequence  749 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_42771.1 cutoff score    98.5058; UAG*CA
Sequence  749 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_90729.1 cutoff score    93.6631; UAG*CA
Sequence  750 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  750 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  750 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  750 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  750 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  751 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  751 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  751 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  751 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  751 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  752 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  752 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  752 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  752 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  752 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  753 in group IL_31462.6 with cutoff score    96.3447 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence  754 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_26793.1 cutoff score    98.4249; CAU*AG
Sequence  754 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_42771.1 cutoff score    97.3523; CAU*AG
Sequence  754 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_51454.3 cutoff score    96.9432; CAU*AG
Sequence  754 in group IL_31462.6 with cutoff score    87.6073 does better against group IL_90729.1 cutoff score    91.9307; CAU*AG
Sequence  757 in group IL_31462.6 with cutoff score    76.2985 does better against group IL_33761.2 cutoff score    78.8557; GAC*GU
Sequence  759 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  759 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  759 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  759 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  759 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  760 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_26793.1 cutoff score    95.2028; UAC*GA
Sequence  760 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_33761.2 cutoff score   100.0000; UAC*GA
Sequence  760 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_42771.1 cutoff score    97.8344; UAC*GA
Sequence  760 in group IL_31462.6 with cutoff score    89.1288 does better against group IL_48076.6 cutoff score    94.4141; UAC*GA
Sequence  761 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_26793.1 cutoff score    96.1333; CAC*GG
Sequence  761 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_33761.2 cutoff score   100.0000; CAC*GG
Sequence  761 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_42771.1 cutoff score    97.3075; CAC*GG
Sequence  761 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_48076.6 cutoff score   100.0000; CAC*GG
Sequence  761 in group IL_31462.6 with cutoff score    92.6711 does better against group IL_51454.3 cutoff score   100.0000; CAC*GG
Sequence  762 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_07039.3 cutoff score    96.4006; UAG*CG
Sequence  762 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_66635.5 cutoff score    89.7621; UAG*CG
Sequence  763 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  763 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  763 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  763 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  763 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  764 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_07039.3 cutoff score    96.4006; UAG*CG
Sequence  764 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_66635.5 cutoff score    89.7621; UAG*CG
Sequence  765 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_07039.3 cutoff score    96.4006; UAG*CG
Sequence  765 in group IL_31462.6 with cutoff score    87.8281 does better against group IL_66635.5 cutoff score    89.7621; UAG*CG
Sequence  766 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_07039.3 cutoff score    93.4870; UAC*GG
Sequence  766 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence  766 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_48076.6 cutoff score    96.2696; UAC*GG
Sequence  766 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_66635.5 cutoff score    89.0823; UAC*GG
Sequence  767 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  767 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  767 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  767 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  767 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  768 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_10569.1 cutoff score    99.3488; UAG*CA
Sequence  768 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_26793.1 cutoff score    99.4990; UAG*CA
Sequence  768 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_42771.1 cutoff score    98.5058; UAG*CA
Sequence  768 in group IL_31462.6 with cutoff score    92.7841 does better against group IL_90729.1 cutoff score    93.6631; UAG*CA
Sequence  769 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  769 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  769 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence  769 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence  769 in group IL_31462.6 with cutoff score    96.3265 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence  770 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_07039.3 cutoff score    93.4870; UAC*GG
Sequence  770 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence  770 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_48076.6 cutoff score    96.2696; UAC*GG
Sequence  770 in group IL_31462.6 with cutoff score    84.1728 does better against group IL_66635.5 cutoff score    89.0823; UAC*GG
Sequence  774 in group IL_31531.3 with cutoff score    79.8169 does better against group IL_57744.1 cutoff score    95.6490; AAAG*CGU
Sequence  782 in group IL_31531.3 with cutoff score    90.0275 does better against group IL_41344.1 cutoff score   100.0000; UAAC*GAG
Sequence  784 in group IL_31531.3 with cutoff score    90.0275 does better against group IL_41344.1 cutoff score   100.0000; UAAC*GAG
Sequence  787 in group IL_31737.3 with cutoff score    80.1276 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence  787 in group IL_31737.3 with cutoff score    80.1276 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence  787 in group IL_31737.3 with cutoff score    80.1276 does better against group IL_42771.1 cutoff score    92.4224; GUC*GUC
Sequence  787 in group IL_31737.3 with cutoff score    80.1276 does better against group IL_87907.2 cutoff score    96.0126; GUC*GUC
Sequence  788 in group IL_31737.3 with cutoff score    80.1276 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence  788 in group IL_31737.3 with cutoff score    80.1276 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence  788 in group IL_31737.3 with cutoff score    80.1276 does better against group IL_42771.1 cutoff score    92.4224; GUC*GUC
Sequence  788 in group IL_31737.3 with cutoff score    80.1276 does better against group IL_87907.2 cutoff score    96.0126; GUC*GUC
Sequence  789 in group IL_31737.3 with cutoff score    84.5009 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence  789 in group IL_31737.3 with cutoff score    84.5009 does better against group IL_26793.1 cutoff score    99.9547; AAG*CU
Sequence  789 in group IL_31737.3 with cutoff score    84.5009 does better against group IL_31462.6 cutoff score    91.7092; AAG*CU
Sequence  789 in group IL_31737.3 with cutoff score    84.5009 does better against group IL_33761.2 cutoff score    86.4028; AAG*CU
Sequence  789 in group IL_31737.3 with cutoff score    84.5009 does better against group IL_42771.1 cutoff score    97.3953; AAG*CU
Sequence  789 in group IL_31737.3 with cutoff score    84.5009 does better against group IL_66635.5 cutoff score    89.1414; AAG*CU
Sequence  789 in group IL_31737.3 with cutoff score    84.5009 does better against group IL_90729.1 cutoff score    96.0385; AAG*CU
Sequence  790 in group IL_31737.3 with cutoff score    86.1773 does better against group IL_31737.3 cutoff score    86.7356; GAG*UAC
Sequence  791 in group IL_31737.3 with cutoff score    70.7312 does better against group IL_07785.1 cutoff score    80.3599; CCG*CCG
Sequence  791 in group IL_31737.3 with cutoff score    70.7312 does better against group IL_87907.2 cutoff score    93.1131; CCG*CCG
Sequence  792 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_08770.1 cutoff score    96.8317; CAC*GAAG
Sequence  792 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_31531.3 cutoff score   100.0000; CAC*GAAG
Sequence  792 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_41344.1 cutoff score   100.0000; CAC*GAAG
Sequence  792 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_55516.2 cutoff score    90.4190; CAC*GAAG
Sequence  792 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_57744.1 cutoff score    92.9639; CAC*GAAG
Sequence  792 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_90351.1 cutoff score    99.2616; CAC*GAAG
Sequence  796 in group IL_31737.3 with cutoff score    56.0520 does better against group IL_42997.3 cutoff score    66.0834; CGC*GACG
Sequence  797 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_08770.1 cutoff score    96.8317; CAC*GAAG
Sequence  797 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_31531.3 cutoff score   100.0000; CAC*GAAG
Sequence  797 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_41344.1 cutoff score   100.0000; CAC*GAAG
Sequence  797 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_55516.2 cutoff score    90.4190; CAC*GAAG
Sequence  797 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_57744.1 cutoff score    92.9639; CAC*GAAG
Sequence  797 in group IL_31737.3 with cutoff score    84.8218 does better against group IL_90351.1 cutoff score    99.2616; CAC*GAAG
Sequence  798 in group IL_31737.3 with cutoff score    24.3389 does better against group IL_10389.1 cutoff score    50.9488; UAA*UCUUG
Sequence  798 in group IL_31737.3 with cutoff score    24.3389 does better against group IL_44325.1 cutoff score    43.2325; UAA*UCUUG
Sequence  807 in group IL_33323.1 with cutoff score    87.5961 does better against group IL_10389.1 cutoff score    89.8935; CCCUUG*CAG
Sequence  812 in group IL_33761.2 with cutoff score    83.9303 does better against group IL_66635.5 cutoff score    84.0578; UGAC*GG
Sequence  812 in group IL_33761.2 with cutoff score    83.9303 does better against group IL_82107.4 cutoff score    87.0723; UGAC*GG
Sequence  813 in group IL_33761.2 with cutoff score    94.5085 does better against group IL_73452.2 cutoff score    97.9089; GUC*GC
Sequence  813 in group IL_33761.2 with cutoff score    94.5085 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence  813 in group IL_33761.2 with cutoff score    94.5085 does better against group IL_89505.4 cutoff score    98.6290; GUC*GC
Sequence  828 in group IL_36516.3 with cutoff score    95.8570 does better against group IL_47972.1 cutoff score    98.7573; GGAUC*GAC
Sequence  847 in group IL_38507.2 with cutoff score    80.4681 does better against group IL_21001.1 cutoff score    86.5165; AUUAU*AGAAU
Sequence  848 in group IL_38507.2 with cutoff score    80.4681 does better against group IL_21001.1 cutoff score    86.5165; AUUAU*AGAAU
Sequence  851 in group IL_38507.2 with cutoff score    91.6935 does better against group IL_89021.2 cutoff score    96.2486; CUAAG*CGAUG
Sequence  856 in group IL_38507.2 with cutoff score    88.8435 does better against group IL_89021.2 cutoff score    94.3880; CUAAA*UGAUG
Sequence  857 in group IL_38507.2 with cutoff score    43.1878 does better against group IL_29471.1 cutoff score    52.1258; CUGAC*GGUG
Sequence  857 in group IL_38507.2 with cutoff score    43.1878 does better against group IL_64231.5 cutoff score    51.7780; CUGAC*GGUG
Sequence  894 in group IL_42626.2 with cutoff score    87.8259 does better against group IL_79895.1 cutoff score    99.2828; CC*GUCG
Sequence  908 in group IL_42771.1 with cutoff score    96.7724 does better against group IL_07785.1 cutoff score    97.3435; UUA*UUA
Sequence  909 in group IL_42771.1 with cutoff score    96.7724 does better against group IL_07785.1 cutoff score    97.3435; UUA*UUA
Sequence  910 in group IL_42771.1 with cutoff score    96.7724 does better against group IL_07785.1 cutoff score    97.3435; UUA*UUA
Sequence  912 in group IL_42771.1 with cutoff score    97.9789 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence  912 in group IL_42771.1 with cutoff score    97.9789 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence  915 in group IL_42997.3 with cutoff score    93.0857 does better against group IL_31737.3 cutoff score    99.5010; CAG*CAG
Sequence  916 in group IL_42997.3 with cutoff score    86.2671 does better against group IL_31737.3 cutoff score   100.0000; GAC*GAC
Sequence  917 in group IL_42997.3 with cutoff score    88.6796 does better against group IL_31737.3 cutoff score    97.9794; AAG*CAU
Sequence  917 in group IL_42997.3 with cutoff score    88.6796 does better against group IL_42997.3 cutoff score    93.0735; AAG*CAU
Sequence  918 in group IL_42997.3 with cutoff score    93.0857 does better against group IL_31737.3 cutoff score    99.5010; CAG*CAG
Sequence  919 in group IL_42997.3 with cutoff score    93.0857 does better against group IL_31737.3 cutoff score    99.5010; CAG*CAG
Sequence  920 in group IL_42997.3 with cutoff score    88.6796 does better against group IL_31737.3 cutoff score    97.9794; AAG*CAU
Sequence  920 in group IL_42997.3 with cutoff score    88.6796 does better against group IL_42997.3 cutoff score    93.0735; AAG*CAU
Sequence  922 in group IL_42997.3 with cutoff score    93.0857 does better against group IL_31737.3 cutoff score    99.5010; CAG*CAG
Sequence  923 in group IL_42997.3 with cutoff score    77.9419 does better against group IL_67095.2 cutoff score    97.8539; UAU*ACA
Sequence  923 in group IL_42997.3 with cutoff score    77.9419 does better against group IL_87907.2 cutoff score    80.2247; UAU*ACA
Sequence  924 in group IL_42997.3 with cutoff score    78.1070 does better against group IL_07785.1 cutoff score    97.3435; UUA*UUA
Sequence  924 in group IL_42997.3 with cutoff score    78.1070 does better against group IL_28037.2 cutoff score    83.0305; UUA*UUA
Sequence  924 in group IL_42997.3 with cutoff score    78.1070 does better against group IL_42771.1 cutoff score    96.7724; UUA*UUA
Sequence  925 in group IL_42997.3 with cutoff score    93.9540 does better against group IL_99358.1 cutoff score    98.9713; CGU*AGUG
Sequence  926 in group IL_42997.3 with cutoff score    93.9540 does better against group IL_99358.1 cutoff score    98.9713; CGU*AGUG
Sequence  928 in group IL_42997.3 with cutoff score    93.9540 does better against group IL_99358.1 cutoff score    98.9713; CGU*AGUG
Sequence  929 in group IL_42997.3 with cutoff score    93.9540 does better against group IL_99358.1 cutoff score    98.9713; CGU*AGUG
Sequence  930 in group IL_42997.3 with cutoff score    93.9540 does better against group IL_99358.1 cutoff score    98.9713; CGU*AGUG
Sequence  931 in group IL_42997.3 with cutoff score    93.9540 does better against group IL_99358.1 cutoff score    98.9713; CGU*AGUG
Sequence  933 in group IL_42997.3 with cutoff score    80.2624 does better against group IL_07785.1 cutoff score   100.0000; GUG*CUC
Sequence  933 in group IL_42997.3 with cutoff score    80.2624 does better against group IL_28037.2 cutoff score    95.6553; GUG*CUC
Sequence  933 in group IL_42997.3 with cutoff score    80.2624 does better against group IL_42771.1 cutoff score    93.5530; GUG*CUC
Sequence  933 in group IL_42997.3 with cutoff score    80.2624 does better against group IL_42997.3 cutoff score    82.0146; GUG*CUC
Sequence  933 in group IL_42997.3 with cutoff score    80.2624 does better against group IL_87907.2 cutoff score    98.5156; GUG*CUC
Sequence  934 in group IL_42997.3 with cutoff score    84.5478 does better against group IL_07785.1 cutoff score   100.0000; CUG*CUG
Sequence  934 in group IL_42997.3 with cutoff score    84.5478 does better against group IL_28037.2 cutoff score    90.2561; CUG*CUG
Sequence  934 in group IL_42997.3 with cutoff score    84.5478 does better against group IL_42771.1 cutoff score    94.2244; CUG*CUG
Sequence  934 in group IL_42997.3 with cutoff score    84.5478 does better against group IL_87907.2 cutoff score   100.0000; CUG*CUG
Sequence  943 in group IL_43644.1 with cutoff score    92.8325 does better against group IL_84251.1 cutoff score    93.8695; CCCG*CCCG
Sequence  950 in group IL_44465.1 with cutoff score    96.9840 does better against group IL_10167.6 cutoff score   100.0000; CGG*CGG
Sequence  955 in group IL_44465.1 with cutoff score    64.8587 does better against group IL_07785.1 cutoff score    99.6185; GUA*UUC
Sequence  955 in group IL_44465.1 with cutoff score    64.8587 does better against group IL_28037.2 cutoff score    91.7444; GUA*UUC
Sequence  955 in group IL_44465.1 with cutoff score    64.8587 does better against group IL_31737.3 cutoff score    77.7893; GUA*UUC
Sequence  955 in group IL_44465.1 with cutoff score    64.8587 does better against group IL_42771.1 cutoff score    95.1150; GUA*UUC
Sequence  955 in group IL_44465.1 with cutoff score    64.8587 does better against group IL_42997.3 cutoff score    78.1535; GUA*UUC
Sequence  955 in group IL_44465.1 with cutoff score    64.8587 does better against group IL_87907.2 cutoff score    86.5527; GUA*UUC
Sequence  956 in group IL_44465.1 with cutoff score    58.1242 does better against group IL_31531.3 cutoff score    67.8725; GGAG*CGC
Sequence  956 in group IL_44465.1 with cutoff score    58.1242 does better against group IL_99358.1 cutoff score    66.6017; GGAG*CGC
Sequence  975 in group IL_47074.2 with cutoff score    78.6775 does better against group IL_82107.4 cutoff score    80.5953; AAGC*GU
Sequence  976 in group IL_47074.2 with cutoff score    58.2762 does better against group IL_99380.1 cutoff score   100.0000; UUUCGA*UG
Sequence  993 in group IL_48076.6 with cutoff score    94.4141 does better against group IL_26793.1 cutoff score    95.2028; UAC*GA
Sequence  993 in group IL_48076.6 with cutoff score    94.4141 does better against group IL_33761.2 cutoff score   100.0000; UAC*GA
Sequence  993 in group IL_48076.6 with cutoff score    94.4141 does better against group IL_42771.1 cutoff score    97.8344; UAC*GA
Sequence  996 in group IL_48076.6 with cutoff score    79.3473 does better against group IL_00225.13 cutoff score    99.0388; UGC*GA
Sequence  996 in group IL_48076.6 with cutoff score    79.3473 does better against group IL_07039.3 cutoff score    82.7600; UGC*GA
Sequence  996 in group IL_48076.6 with cutoff score    79.3473 does better against group IL_16386.4 cutoff score    95.6869; UGC*GA
Sequence  996 in group IL_48076.6 with cutoff score    79.3473 does better against group IL_66635.5 cutoff score    94.3283; UGC*GA
Sequence  997 in group IL_48076.6 with cutoff score    87.3051 does better against group IL_73452.2 cutoff score    97.1819; GUA*UC
Sequence  997 in group IL_48076.6 with cutoff score    87.3051 does better against group IL_81831.1 cutoff score   100.0000; GUA*UC
Sequence  997 in group IL_48076.6 with cutoff score    87.3051 does better against group IL_89505.4 cutoff score    93.2895; GUA*UC
Sequence  997 in group IL_48076.6 with cutoff score    87.3051 does better against group IL_90729.1 cutoff score    92.5803; GUA*UC
Sequence  998 in group IL_48076.6 with cutoff score    96.2696 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence  999 in group IL_48076.6 with cutoff score    92.2642 does better against group IL_07039.3 cutoff score    94.3443; UAA*UG
Sequence 1000 in group IL_48076.6 with cutoff score    92.2642 does better against group IL_07039.3 cutoff score    94.3443; UAA*UG
Sequence 1002 in group IL_48076.6 with cutoff score    91.0117 does better against group IL_33761.2 cutoff score    92.8880; UUC*GG
Sequence 1003 in group IL_48076.6 with cutoff score    84.9332 does better against group IL_00225.13 cutoff score    99.4453; CGC*GG
Sequence 1003 in group IL_48076.6 with cutoff score    84.9332 does better against group IL_16386.4 cutoff score    97.8877; CGC*GG
Sequence 1003 in group IL_48076.6 with cutoff score    84.9332 does better against group IL_66635.5 cutoff score    95.4801; CGC*GG
Sequence 1004 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_10569.1 cutoff score    97.0299; CAA*UG
Sequence 1004 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_26793.1 cutoff score    96.6030; CAA*UG
Sequence 1004 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_42771.1 cutoff score   100.0000; CAA*UG
Sequence 1005 in group IL_48076.6 with cutoff score    96.2696 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence 1006 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_10569.1 cutoff score    97.0299; CAA*UG
Sequence 1006 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_26793.1 cutoff score    96.6030; CAA*UG
Sequence 1006 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_42771.1 cutoff score   100.0000; CAA*UG
Sequence 1007 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_10569.1 cutoff score    97.0299; CAA*UG
Sequence 1007 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_26793.1 cutoff score    96.6030; CAA*UG
Sequence 1007 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_42771.1 cutoff score   100.0000; CAA*UG
Sequence 1008 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_10569.1 cutoff score    97.0299; CAA*UG
Sequence 1008 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_26793.1 cutoff score    96.6030; CAA*UG
Sequence 1008 in group IL_48076.6 with cutoff score    95.9947 does better against group IL_42771.1 cutoff score   100.0000; CAA*UG
Sequence 1009 in group IL_48076.6 with cutoff score    80.6837 does better against group IL_00225.13 cutoff score    96.1564; GGC*GC
Sequence 1009 in group IL_48076.6 with cutoff score    80.6837 does better against group IL_16386.4 cutoff score    95.7757; GGC*GC
Sequence 1009 in group IL_48076.6 with cutoff score    80.6837 does better against group IL_66635.5 cutoff score   100.0000; GGC*GC
Sequence 1010 in group IL_48076.6 with cutoff score    94.7421 does better against group IL_73452.2 cutoff score    97.3474; CUC*GG
Sequence 1010 in group IL_48076.6 with cutoff score    94.7421 does better against group IL_81831.1 cutoff score    98.6984; CUC*GG
Sequence 1011 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence 1011 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence 1011 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_31462.6 cutoff score    96.3265; CAG*CG
Sequence 1011 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_31737.3 cutoff score    86.0225; CAG*CG
Sequence 1011 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_33761.2 cutoff score    87.4637; CAG*CG
Sequence 1011 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence 1011 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence 1011 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_66635.5 cutoff score    89.2765; CAG*CG
Sequence 1011 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence 1012 in group IL_48076.6 with cutoff score    96.2696 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence 1013 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence 1013 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence 1013 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_31462.6 cutoff score    96.3265; CAG*CG
Sequence 1013 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_31737.3 cutoff score    86.0225; CAG*CG
Sequence 1013 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_33761.2 cutoff score    87.4637; CAG*CG
Sequence 1013 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence 1013 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence 1013 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_66635.5 cutoff score    89.2765; CAG*CG
Sequence 1013 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence 1014 in group IL_48076.6 with cutoff score    82.9121 does better against group IL_00225.13 cutoff score    94.6037; UGG*CG
Sequence 1014 in group IL_48076.6 with cutoff score    82.9121 does better against group IL_07039.3 cutoff score   100.0000; UGG*CG
Sequence 1014 in group IL_48076.6 with cutoff score    82.9121 does better against group IL_66635.5 cutoff score    96.6455; UGG*CG
Sequence 1016 in group IL_48076.6 with cutoff score    84.9332 does better against group IL_00225.13 cutoff score    99.4453; CGC*GG
Sequence 1016 in group IL_48076.6 with cutoff score    84.9332 does better against group IL_16386.4 cutoff score    97.8877; CGC*GG
Sequence 1016 in group IL_48076.6 with cutoff score    84.9332 does better against group IL_66635.5 cutoff score    95.4801; CGC*GG
Sequence 1017 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence 1017 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence 1017 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_31462.6 cutoff score    96.3265; CAG*CG
Sequence 1017 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_31737.3 cutoff score    86.0225; CAG*CG
Sequence 1017 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_33761.2 cutoff score    87.4637; CAG*CG
Sequence 1017 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence 1017 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_51454.3 cutoff score    96.9743; CAG*CG
Sequence 1017 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_66635.5 cutoff score    89.2765; CAG*CG
Sequence 1017 in group IL_48076.6 with cutoff score    85.2123 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence 1018 in group IL_48076.6 with cutoff score    87.0230 does better against group IL_26793.1 cutoff score    89.3669; GCA*UC
Sequence 1018 in group IL_48076.6 with cutoff score    87.0230 does better against group IL_61258.15 cutoff score    96.1200; GCA*UC
Sequence 1019 in group IL_48076.6 with cutoff score    87.0230 does better against group IL_26793.1 cutoff score    89.3669; GCA*UC
Sequence 1019 in group IL_48076.6 with cutoff score    87.0230 does better against group IL_61258.15 cutoff score    96.1200; GCA*UC
Sequence 1020 in group IL_48076.6 with cutoff score    95.2383 does better against group IL_63775.1 cutoff score    99.2157; CCC*GG
Sequence 1021 in group IL_48076.6 with cutoff score    95.2383 does better against group IL_63775.1 cutoff score    99.2157; CCC*GG
Sequence 1022 in group IL_48076.6 with cutoff score    95.2383 does better against group IL_63775.1 cutoff score    99.2157; CCC*GG
Sequence 1023 in group IL_48076.6 with cutoff score    78.9321 does better against group IL_00225.13 cutoff score    97.6627; UGA*UG
Sequence 1023 in group IL_48076.6 with cutoff score    78.9321 does better against group IL_07039.3 cutoff score    97.9437; UGA*UG
Sequence 1023 in group IL_48076.6 with cutoff score    78.9321 does better against group IL_66635.5 cutoff score    93.0924; UGA*UG
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_00881.1 cutoff score    95.8615; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_02555.1 cutoff score    85.2469; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_14368.1 cutoff score    56.4792; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_15052.4 cutoff score    97.3956; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_42626.2 cutoff score    64.6869; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_50694.7 cutoff score    55.5341; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_68140.4 cutoff score    91.3389; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_73355.1 cutoff score    97.0599; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_73452.2 cutoff score    66.4054; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_76709.2 cutoff score    92.8101; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_79895.1 cutoff score    54.7404; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_81831.1 cutoff score    92.0531; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_82107.4 cutoff score    93.5230; AAAA*UU
Sequence 1024 in group IL_48076.6 with cutoff score    52.3775 does better against group IL_95583.2 cutoff score    74.5362; AAAA*UU
Sequence 1025 in group IL_48076.6 with cutoff score    78.9321 does better against group IL_00225.13 cutoff score    97.6627; UGA*UG
Sequence 1025 in group IL_48076.6 with cutoff score    78.9321 does better against group IL_07039.3 cutoff score    97.9437; UGA*UG
Sequence 1025 in group IL_48076.6 with cutoff score    78.9321 does better against group IL_66635.5 cutoff score    93.0924; UGA*UG
Sequence 1026 in group IL_48076.6 with cutoff score    87.8241 does better against group IL_07039.3 cutoff score    87.8250; UUA*UG
Sequence 1027 in group IL_48076.6 with cutoff score    95.7505 does better against group IL_31462.6 cutoff score    96.3447; GAC*GC
Sequence 1027 in group IL_48076.6 with cutoff score    95.7505 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence 1027 in group IL_48076.6 with cutoff score    95.7505 does better against group IL_42771.1 cutoff score    96.1769; GAC*GC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_00881.1 cutoff score    96.0859; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_02555.1 cutoff score    85.3996; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_14368.1 cutoff score    56.2853; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_15052.4 cutoff score    67.3531; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_42626.2 cutoff score    61.9648; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_50694.7 cutoff score    60.6843; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_68140.4 cutoff score    95.9789; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_73355.1 cutoff score    97.2843; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_73452.2 cutoff score    67.6940; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_76709.2 cutoff score    93.5082; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_79895.1 cutoff score    56.0751; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_81831.1 cutoff score    92.7037; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_82107.4 cutoff score    96.1652; GAAA*UC
Sequence 1028 in group IL_48076.6 with cutoff score    55.7770 does better against group IL_95583.2 cutoff score    75.3185; GAAA*UC
Sequence 1029 in group IL_48076.6 with cutoff score    95.7505 does better against group IL_31462.6 cutoff score    96.3447; GAC*GC
Sequence 1029 in group IL_48076.6 with cutoff score    95.7505 does better against group IL_33761.2 cutoff score    99.8856; GAC*GC
Sequence 1029 in group IL_48076.6 with cutoff score    95.7505 does better against group IL_42771.1 cutoff score    96.1769; GAC*GC
Sequence 1030 in group IL_48076.6 with cutoff score    62.2689 does better against group IL_00225.13 cutoff score    79.2343; UGU*GA
Sequence 1030 in group IL_48076.6 with cutoff score    62.2689 does better against group IL_07039.3 cutoff score    68.7356; UGU*GA
Sequence 1030 in group IL_48076.6 with cutoff score    62.2689 does better against group IL_16386.4 cutoff score    72.9711; UGU*GA
Sequence 1030 in group IL_48076.6 with cutoff score    62.2689 does better against group IL_66635.5 cutoff score    68.8575; UGU*GA
Sequence 1031 in group IL_48076.6 with cutoff score    45.3861 does better against group IL_50694.7 cutoff score    52.1296; UUUC*GG
Sequence 1031 in group IL_48076.6 with cutoff score    45.3861 does better against group IL_56987.1 cutoff score    76.6446; UUUC*GG
Sequence 1031 in group IL_48076.6 with cutoff score    45.3861 does better against group IL_66635.5 cutoff score    88.9171; UUUC*GG
Sequence 1031 in group IL_48076.6 with cutoff score    45.3861 does better against group IL_82107.4 cutoff score    78.1477; UUUC*GG
Sequence 1031 in group IL_48076.6 with cutoff score    45.3861 does better against group IL_84476.1 cutoff score    72.1992; UUUC*GG
Sequence 1035 in group IL_48444.6 with cutoff score    79.1037 does better against group IL_23774.1 cutoff score    83.0112; CGAU*AGAAG
Sequence 1035 in group IL_48444.6 with cutoff score    79.1037 does better against group IL_77691.5 cutoff score    89.4384; CGAU*AGAAG
Sequence 1037 in group IL_49061.1 with cutoff score    83.5299 does better against group IL_61299.4 cutoff score    86.7446; CGGAAA*UGG
Sequence 1040 in group IL_49061.1 with cutoff score    88.3847 does better against group IL_36516.3 cutoff score    95.8570; GGAUC*GAC
Sequence 1040 in group IL_49061.1 with cutoff score    88.3847 does better against group IL_47972.1 cutoff score    98.7573; GGAUC*GAC
Sequence 1041 in group IL_49061.1 with cutoff score    25.4186 does better against group IL_82706.1 cutoff score    66.7528; UCUGUGA*UGG
Sequence 1044 in group IL_49714.1 with cutoff score   100.0000 does better against group IL_88017.1 cutoff score   100.0000; GAACUAC*GC
Sequence 1047 in group IL_49751.4 with cutoff score    99.4545 does better against group IL_49751.4 cutoff score   100.0000; CUUUG*CUCUG
Sequence 1050 in group IL_49751.4 with cutoff score    99.4545 does better against group IL_49751.4 cutoff score   100.0000; CUUUG*CUCUG
Sequence 1051 in group IL_49751.4 with cutoff score    86.5854 does better against group IL_49751.4 cutoff score    94.1023; CCUUG*CUCCG
Sequence 1056 in group IL_49751.4 with cutoff score    69.5920 does better against group IL_63519.1 cutoff score   100.0000; GAUAC*GCAGC
Sequence 1077 in group IL_50694.7 with cutoff score    79.2152 does better against group IL_66635.5 cutoff score    82.2519; CAUU*AG
Sequence 1077 in group IL_50694.7 with cutoff score    79.2152 does better against group IL_76709.2 cutoff score    97.6090; CAUU*AG
Sequence 1077 in group IL_50694.7 with cutoff score    79.2152 does better against group IL_79895.1 cutoff score    98.7500; CAUU*AG
Sequence 1077 in group IL_50694.7 with cutoff score    79.2152 does better against group IL_82107.4 cutoff score    87.6717; CAUU*AG
Sequence 1077 in group IL_50694.7 with cutoff score    79.2152 does better against group IL_84476.1 cutoff score    81.3766; CAUU*AG
Sequence 1080 in group IL_50694.7 with cutoff score    91.4367 does better against group IL_66635.5 cutoff score    93.6553; GGUU*AC
Sequence 1086 in group IL_50694.7 with cutoff score    86.9636 does better against group IL_56987.1 cutoff score    99.3578; GUUU*AC
Sequence 1086 in group IL_50694.7 with cutoff score    86.9636 does better against group IL_66635.5 cutoff score    89.5957; GUUU*AC
Sequence 1086 in group IL_50694.7 with cutoff score    86.9636 does better against group IL_84476.1 cutoff score    96.4125; GUUU*AC
Sequence 1089 in group IL_50694.7 with cutoff score    91.4367 does better against group IL_66635.5 cutoff score    93.6553; GGUU*AC
Sequence 1090 in group IL_50694.7 with cutoff score    91.4367 does better against group IL_66635.5 cutoff score    93.6553; GGUU*AC
Sequence 1091 in group IL_50694.7 with cutoff score    91.4367 does better against group IL_66635.5 cutoff score    93.6553; GGUU*AC
Sequence 1092 in group IL_50694.7 with cutoff score    70.2297 does better against group IL_56987.1 cutoff score    99.4707; CUUC*GG
Sequence 1092 in group IL_50694.7 with cutoff score    70.2297 does better against group IL_66635.5 cutoff score    88.4316; CUUC*GG
Sequence 1092 in group IL_50694.7 with cutoff score    70.2297 does better against group IL_82107.4 cutoff score    76.0070; CUUC*GG
Sequence 1092 in group IL_50694.7 with cutoff score    70.2297 does better against group IL_84476.1 cutoff score    96.7167; CUUC*GG
Sequence 1093 in group IL_50694.7 with cutoff score    72.3069 does better against group IL_66635.5 cutoff score    89.6210; UGUU*AG
Sequence 1093 in group IL_50694.7 with cutoff score    72.3069 does better against group IL_82107.4 cutoff score    76.8656; UGUU*AG
Sequence 1094 in group IL_50694.7 with cutoff score    76.6050 does better against group IL_66635.5 cutoff score    85.6077; CAUC*GG
Sequence 1094 in group IL_50694.7 with cutoff score    76.6050 does better against group IL_76709.2 cutoff score    99.3539; CAUC*GG
Sequence 1094 in group IL_50694.7 with cutoff score    76.6050 does better against group IL_79895.1 cutoff score    98.7541; CAUC*GG
Sequence 1094 in group IL_50694.7 with cutoff score    76.6050 does better against group IL_82107.4 cutoff score    86.9427; CAUC*GG
Sequence 1094 in group IL_50694.7 with cutoff score    76.6050 does better against group IL_84476.1 cutoff score    82.5069; CAUC*GG
Sequence 1095 in group IL_50694.7 with cutoff score    76.6050 does better against group IL_66635.5 cutoff score    85.6077; CAUC*GG
Sequence 1095 in group IL_50694.7 with cutoff score    76.6050 does better against group IL_76709.2 cutoff score    99.3539; CAUC*GG
Sequence 1095 in group IL_50694.7 with cutoff score    76.6050 does better against group IL_79895.1 cutoff score    98.7541; CAUC*GG
Sequence 1095 in group IL_50694.7 with cutoff score    76.6050 does better against group IL_82107.4 cutoff score    86.9427; CAUC*GG
Sequence 1095 in group IL_50694.7 with cutoff score    76.6050 does better against group IL_84476.1 cutoff score    82.5069; CAUC*GG
Sequence 1105 in group IL_50730.2 with cutoff score    98.9169 does better against group IL_61440.1 cutoff score    99.3638; UGAAG*UGGAA
Sequence 1127 in group IL_51387.2 with cutoff score    99.8554 does better against group IL_99358.1 cutoff score   100.0000; GGUU*AUC
Sequence 1129 in group IL_51387.2 with cutoff score    99.8554 does better against group IL_99358.1 cutoff score   100.0000; GGUU*AUC
Sequence 1140 in group IL_51387.2 with cutoff score    89.9483 does better against group IL_22373.1 cutoff score    94.9638; GGUUU*AUC
Sequence 1141 in group IL_51387.2 with cutoff score    89.9483 does better against group IL_22373.1 cutoff score    94.9638; GGUUU*AUC
Sequence 1142 in group IL_51387.2 with cutoff score    89.9483 does better against group IL_22373.1 cutoff score    94.9638; GGUUU*AUC
Sequence 1143 in group IL_51387.2 with cutoff score    86.0264 does better against group IL_22373.1 cutoff score    93.4197; UGUUU*AUA
Sequence 1144 in group IL_51387.2 with cutoff score    77.2982 does better against group IL_61438.4 cutoff score    98.1391; CAAC*GCG
Sequence 1144 in group IL_51387.2 with cutoff score    77.2982 does better against group IL_90351.1 cutoff score    85.9849; CAAC*GCG
Sequence 1145 in group IL_51387.2 with cutoff score    53.3529 does better against group IL_14688.1 cutoff score    57.5921; CUCC*GUG
Sequence 1146 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 1146 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 1146 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_89505.4 cutoff score    88.9804; CUG*CG
Sequence 1146 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 1147 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_26793.1 cutoff score    77.0112; UUU*AA
Sequence 1147 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_33761.2 cutoff score    82.0528; UUU*AA
Sequence 1147 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_48076.6 cutoff score    77.2882; UUU*AA
Sequence 1147 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_73452.2 cutoff score    95.8029; UUU*AA
Sequence 1147 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_81831.1 cutoff score    99.2167; UUU*AA
Sequence 1147 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_89505.4 cutoff score    80.5454; UUU*AA
Sequence 1147 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_90729.1 cutoff score    84.4785; UUU*AA
Sequence 1148 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 1148 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 1148 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_89505.4 cutoff score    88.9804; CUG*CG
Sequence 1148 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 1149 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 1149 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 1149 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_89505.4 cutoff score    88.9804; CUG*CG
Sequence 1149 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 1150 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_26793.1 cutoff score    77.0112; UUU*AA
Sequence 1150 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_33761.2 cutoff score    82.0528; UUU*AA
Sequence 1150 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_48076.6 cutoff score    77.2882; UUU*AA
Sequence 1150 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_73452.2 cutoff score    95.8029; UUU*AA
Sequence 1150 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_81831.1 cutoff score    99.2167; UUU*AA
Sequence 1150 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_89505.4 cutoff score    80.5454; UUU*AA
Sequence 1150 in group IL_51454.3 with cutoff score    75.3604 does better against group IL_90729.1 cutoff score    84.4785; UUU*AA
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_22551.4 cutoff score    65.8425; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_42626.2 cutoff score    48.5575; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_50694.7 cutoff score    70.2433; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_56987.1 cutoff score    99.5123; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_59877.1 cutoff score    49.0337; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_66635.5 cutoff score    89.1114; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_73452.2 cutoff score    63.0439; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_76709.2 cutoff score    43.5929; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_79895.1 cutoff score    66.4580; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_81831.1 cutoff score    48.9766; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_82107.4 cutoff score    74.3683; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_84476.1 cutoff score    99.1739; CUUG*CG
Sequence 1151 in group IL_51454.3 with cutoff score    40.5169 does better against group IL_94967.1 cutoff score    42.6148; CUUG*CG
Sequence 1153 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_07039.3 cutoff score    82.0742; UAG*CA
Sequence 1153 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_10569.1 cutoff score    99.3488; UAG*CA
Sequence 1153 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_26793.1 cutoff score    99.4990; UAG*CA
Sequence 1153 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_31462.6 cutoff score    92.7841; UAG*CA
Sequence 1153 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_31737.3 cutoff score    83.8861; UAG*CA
Sequence 1153 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_33761.2 cutoff score    87.5188; UAG*CA
Sequence 1153 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_42771.1 cutoff score    98.5058; UAG*CA
Sequence 1153 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_66635.5 cutoff score    88.1247; UAG*CA
Sequence 1153 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_90729.1 cutoff score    93.6631; UAG*CA
Sequence 1156 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 1156 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 1156 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_89505.4 cutoff score    88.9804; CUG*CG
Sequence 1156 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 1159 in group IL_51454.3 with cutoff score    76.0204 does better against group IL_07039.3 cutoff score    93.4870; UAC*GG
Sequence 1159 in group IL_51454.3 with cutoff score    76.0204 does better against group IL_31462.6 cutoff score    84.1728; UAC*GG
Sequence 1159 in group IL_51454.3 with cutoff score    76.0204 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence 1159 in group IL_51454.3 with cutoff score    76.0204 does better against group IL_42771.1 cutoff score    79.1997; UAC*GG
Sequence 1159 in group IL_51454.3 with cutoff score    76.0204 does better against group IL_48076.6 cutoff score    96.2696; UAC*GG
Sequence 1159 in group IL_51454.3 with cutoff score    76.0204 does better against group IL_66635.5 cutoff score    89.0823; UAC*GG
Sequence 1161 in group IL_51454.3 with cutoff score    96.9743 does better against group IL_10569.1 cutoff score   100.0000; CAG*CG
Sequence 1161 in group IL_51454.3 with cutoff score    96.9743 does better against group IL_26793.1 cutoff score   100.0000; CAG*CG
Sequence 1161 in group IL_51454.3 with cutoff score    96.9743 does better against group IL_42771.1 cutoff score    97.9789; CAG*CG
Sequence 1161 in group IL_51454.3 with cutoff score    96.9743 does better against group IL_90729.1 cutoff score    97.3152; CAG*CG
Sequence 1162 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 1162 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 1162 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_89505.4 cutoff score    88.9804; CUG*CG
Sequence 1162 in group IL_51454.3 with cutoff score    87.1446 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 1163 in group IL_51454.3 with cutoff score    72.7893 does better against group IL_26793.1 cutoff score    89.3216; ACA*UU
Sequence 1163 in group IL_51454.3 with cutoff score    72.7893 does better against group IL_48076.6 cutoff score    83.6234; ACA*UU
Sequence 1163 in group IL_51454.3 with cutoff score    72.7893 does better against group IL_61258.15 cutoff score    89.9428; ACA*UU
Sequence 1164 in group IL_51454.3 with cutoff score    71.5075 does better against group IL_07039.3 cutoff score    73.0535; GAA*UC
Sequence 1164 in group IL_51454.3 with cutoff score    71.5075 does better against group IL_10569.1 cutoff score    96.4413; GAA*UC
Sequence 1164 in group IL_51454.3 with cutoff score    71.5075 does better against group IL_26793.1 cutoff score    96.1735; GAA*UC
Sequence 1164 in group IL_51454.3 with cutoff score    71.5075 does better against group IL_31462.6 cutoff score    89.3606; GAA*UC
Sequence 1164 in group IL_51454.3 with cutoff score    71.5075 does better against group IL_31737.3 cutoff score    85.0581; GAA*UC
Sequence 1164 in group IL_51454.3 with cutoff score    71.5075 does better against group IL_33761.2 cutoff score    87.1249; GAA*UC
Sequence 1164 in group IL_51454.3 with cutoff score    71.5075 does better against group IL_42771.1 cutoff score    98.8694; GAA*UC
Sequence 1164 in group IL_51454.3 with cutoff score    71.5075 does better against group IL_48076.6 cutoff score    91.7452; GAA*UC
Sequence 1164 in group IL_51454.3 with cutoff score    71.5075 does better against group IL_66635.5 cutoff score    90.2433; GAA*UC
Sequence 1164 in group IL_51454.3 with cutoff score    71.5075 does better against group IL_90729.1 cutoff score    96.3805; GAA*UC
Sequence 1165 in group IL_51454.3 with cutoff score    72.7893 does better against group IL_26793.1 cutoff score    89.3216; ACA*UU
Sequence 1165 in group IL_51454.3 with cutoff score    72.7893 does better against group IL_48076.6 cutoff score    83.6234; ACA*UU
Sequence 1165 in group IL_51454.3 with cutoff score    72.7893 does better against group IL_61258.15 cutoff score    89.9428; ACA*UU
Sequence 1166 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_42626.2 cutoff score    92.8812; UACC*GA
Sequence 1166 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_76709.2 cutoff score    94.5682; UACC*GA
Sequence 1166 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_82107.4 cutoff score    81.2279; UACC*GA
Sequence 1169 in group IL_51454.3 with cutoff score    66.9041 does better against group IL_26793.1 cutoff score    91.6183; CCU*AG
Sequence 1169 in group IL_51454.3 with cutoff score    66.9041 does better against group IL_48076.6 cutoff score    69.1572; CCU*AG
Sequence 1169 in group IL_51454.3 with cutoff score    66.9041 does better against group IL_61258.15 cutoff score    92.3218; CCU*AG
Sequence 1169 in group IL_51454.3 with cutoff score    66.9041 does better against group IL_63775.1 cutoff score    98.9913; CCU*AG
Sequence 1169 in group IL_51454.3 with cutoff score    66.9041 does better against group IL_90729.1 cutoff score    72.0669; CCU*AG
Sequence 1171 in group IL_51454.3 with cutoff score    96.9432 does better against group IL_26793.1 cutoff score    98.4249; CAU*AG
Sequence 1171 in group IL_51454.3 with cutoff score    96.9432 does better against group IL_42771.1 cutoff score    97.3523; CAU*AG
Sequence 1172 in group IL_51454.3 with cutoff score    73.4040 does better against group IL_07039.3 cutoff score    75.1098; GAG*CC
Sequence 1172 in group IL_51454.3 with cutoff score    73.4040 does better against group IL_10569.1 cutoff score    99.4113; GAG*CC
Sequence 1172 in group IL_51454.3 with cutoff score    73.4040 does better against group IL_26793.1 cutoff score   100.0000; GAG*CC
Sequence 1172 in group IL_51454.3 with cutoff score    73.4040 does better against group IL_31462.6 cutoff score   100.0000; GAG*CC
Sequence 1172 in group IL_51454.3 with cutoff score    73.4040 does better against group IL_31737.3 cutoff score    86.5215; GAG*CC
Sequence 1172 in group IL_51454.3 with cutoff score    73.4040 does better against group IL_33761.2 cutoff score    87.3493; GAG*CC
Sequence 1172 in group IL_51454.3 with cutoff score    73.4040 does better against group IL_42771.1 cutoff score    96.8483; GAG*CC
Sequence 1172 in group IL_51454.3 with cutoff score    73.4040 does better against group IL_48076.6 cutoff score    80.9628; GAG*CC
Sequence 1172 in group IL_51454.3 with cutoff score    73.4040 does better against group IL_66635.5 cutoff score    93.7964; GAG*CC
Sequence 1172 in group IL_51454.3 with cutoff score    73.4040 does better against group IL_90729.1 cutoff score   100.0000; GAG*CC
Sequence 1173 in group IL_51454.3 with cutoff score    77.1484 does better against group IL_42626.2 cutoff score    92.6752; UACU*AA
Sequence 1173 in group IL_51454.3 with cutoff score    77.1484 does better against group IL_76709.2 cutoff score    92.8232; UACU*AA
Sequence 1173 in group IL_51454.3 with cutoff score    77.1484 does better against group IL_82107.4 cutoff score    81.9569; UACU*AA
Sequence 1175 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_07039.3 cutoff score    82.0742; UAG*CA
Sequence 1175 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_10569.1 cutoff score    99.3488; UAG*CA
Sequence 1175 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_26793.1 cutoff score    99.4990; UAG*CA
Sequence 1175 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_31462.6 cutoff score    92.7841; UAG*CA
Sequence 1175 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_31737.3 cutoff score    83.8861; UAG*CA
Sequence 1175 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_33761.2 cutoff score    87.5188; UAG*CA
Sequence 1175 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_42771.1 cutoff score    98.5058; UAG*CA
Sequence 1175 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_66635.5 cutoff score    88.1247; UAG*CA
Sequence 1175 in group IL_51454.3 with cutoff score    81.6354 does better against group IL_90729.1 cutoff score    93.6631; UAG*CA
Sequence 1176 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_42626.2 cutoff score    92.8812; UACC*GA
Sequence 1176 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_76709.2 cutoff score    94.5682; UACC*GA
Sequence 1176 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_82107.4 cutoff score    81.2279; UACC*GA
Sequence 1177 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_42626.2 cutoff score    92.8812; UACC*GA
Sequence 1177 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_76709.2 cutoff score    94.5682; UACC*GA
Sequence 1177 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_82107.4 cutoff score    81.2279; UACC*GA
Sequence 1179 in group IL_51454.3 with cutoff score    96.9432 does better against group IL_26793.1 cutoff score    98.4249; CAU*AG
Sequence 1179 in group IL_51454.3 with cutoff score    96.9432 does better against group IL_42771.1 cutoff score    97.3523; CAU*AG
Sequence 1180 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_42626.2 cutoff score    92.8812; UACC*GA
Sequence 1180 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_76709.2 cutoff score    94.5682; UACC*GA
Sequence 1180 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_82107.4 cutoff score    81.2279; UACC*GA
Sequence 1182 in group IL_51454.3 with cutoff score    67.8027 does better against group IL_07039.3 cutoff score    87.8250; UUA*UG
Sequence 1182 in group IL_51454.3 with cutoff score    67.8027 does better against group IL_33761.2 cutoff score    80.1273; UUA*UG
Sequence 1182 in group IL_51454.3 with cutoff score    67.8027 does better against group IL_48076.6 cutoff score    87.8241; UUA*UG
Sequence 1182 in group IL_51454.3 with cutoff score    67.8027 does better against group IL_73452.2 cutoff score    73.7943; UUA*UG
Sequence 1182 in group IL_51454.3 with cutoff score    67.8027 does better against group IL_81831.1 cutoff score    82.0343; UUA*UG
Sequence 1182 in group IL_51454.3 with cutoff score    67.8027 does better against group IL_89505.4 cutoff score    76.8371; UUA*UG
Sequence 1182 in group IL_51454.3 with cutoff score    67.8027 does better against group IL_90729.1 cutoff score    70.6331; UUA*UG
Sequence 1183 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_42626.2 cutoff score    92.8812; UACC*GA
Sequence 1183 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_76709.2 cutoff score    94.5682; UACC*GA
Sequence 1183 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_82107.4 cutoff score    81.2279; UACC*GA
Sequence 1184 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_42626.2 cutoff score    92.8812; UACC*GA
Sequence 1184 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_76709.2 cutoff score    94.5682; UACC*GA
Sequence 1184 in group IL_51454.3 with cutoff score    80.2052 does better against group IL_82107.4 cutoff score    81.2279; UACC*GA
Sequence 1185 in group IL_51454.3 with cutoff score    73.3729 does better against group IL_07039.3 cutoff score    74.3208; GAU*AC
Sequence 1185 in group IL_51454.3 with cutoff score    73.3729 does better against group IL_26793.1 cutoff score    97.9954; GAU*AC
Sequence 1185 in group IL_51454.3 with cutoff score    73.3729 does better against group IL_31462.6 cutoff score    91.2808; GAU*AC
Sequence 1185 in group IL_51454.3 with cutoff score    73.3729 does better against group IL_31737.3 cutoff score    84.2928; GAU*AC
Sequence 1185 in group IL_51454.3 with cutoff score    73.3729 does better against group IL_33761.2 cutoff score    87.2605; GAU*AC
Sequence 1185 in group IL_51454.3 with cutoff score    73.3729 does better against group IL_42771.1 cutoff score    96.2217; GAU*AC
Sequence 1185 in group IL_51454.3 with cutoff score    73.3729 does better against group IL_66635.5 cutoff score    89.7608; GAU*AC
Sequence 1185 in group IL_51454.3 with cutoff score    73.3729 does better against group IL_90729.1 cutoff score    94.6156; GAU*AC
Sequence 1186 in group IL_51454.3 with cutoff score    96.9432 does better against group IL_26793.1 cutoff score    98.4249; CAU*AG
Sequence 1186 in group IL_51454.3 with cutoff score    96.9432 does better against group IL_42771.1 cutoff score    97.3523; CAU*AG
Sequence 1187 in group IL_51454.3 with cutoff score    66.9041 does better against group IL_26793.1 cutoff score    91.6183; CCU*AG
Sequence 1187 in group IL_51454.3 with cutoff score    66.9041 does better against group IL_48076.6 cutoff score    69.1572; CCU*AG
Sequence 1187 in group IL_51454.3 with cutoff score    66.9041 does better against group IL_61258.15 cutoff score    92.3218; CCU*AG
Sequence 1187 in group IL_51454.3 with cutoff score    66.9041 does better against group IL_63775.1 cutoff score    98.9913; CCU*AG
Sequence 1187 in group IL_51454.3 with cutoff score    66.9041 does better against group IL_90729.1 cutoff score    72.0669; CCU*AG
Sequence 1188 in group IL_51454.3 with cutoff score    96.9432 does better against group IL_26793.1 cutoff score    98.4249; CAU*AG
Sequence 1188 in group IL_51454.3 with cutoff score    96.9432 does better against group IL_42771.1 cutoff score    97.3523; CAU*AG
Sequence 1189 in group IL_51454.3 with cutoff score    79.7389 does better against group IL_07039.3 cutoff score    80.0179; UAA*UA
Sequence 1189 in group IL_51454.3 with cutoff score    79.7389 does better against group IL_10569.1 cutoff score    96.3788; UAA*UA
Sequence 1189 in group IL_51454.3 with cutoff score    79.7389 does better against group IL_26793.1 cutoff score    95.6726; UAA*UA
Sequence 1189 in group IL_51454.3 with cutoff score    79.7389 does better against group IL_31462.6 cutoff score    82.1447; UAA*UA
Sequence 1189 in group IL_51454.3 with cutoff score    79.7389 does better against group IL_31737.3 cutoff score    82.4226; UAA*UA
Sequence 1189 in group IL_51454.3 with cutoff score    79.7389 does better against group IL_33761.2 cutoff score    87.2944; UAA*UA
Sequence 1189 in group IL_51454.3 with cutoff score    79.7389 does better against group IL_42771.1 cutoff score   100.0000; UAA*UA
Sequence 1189 in group IL_51454.3 with cutoff score    79.7389 does better against group IL_48076.6 cutoff score    90.4088; UAA*UA
Sequence 1189 in group IL_51454.3 with cutoff score    79.7389 does better against group IL_66635.5 cutoff score    84.5716; UAA*UA
Sequence 1189 in group IL_51454.3 with cutoff score    79.7389 does better against group IL_90729.1 cutoff score    90.0436; UAA*UA
Sequence 1196 in group IL_51479.1 with cutoff score    83.6660 does better against group IL_77658.1 cutoff score   100.0000; CUUG*CUUG
Sequence 1199 in group IL_51479.1 with cutoff score    83.6660 does better against group IL_77658.1 cutoff score   100.0000; CUUG*CUUG
Sequence 1200 in group IL_51479.1 with cutoff score    67.3751 does better against group IL_51479.1 cutoff score    69.6868; AAUG*CAUU
Sequence 1232 in group IL_55516.2 with cutoff score    90.4190 does better against group IL_08770.1 cutoff score    96.8317; GAAG*CAC
Sequence 1232 in group IL_55516.2 with cutoff score    90.4190 does better against group IL_31531.3 cutoff score   100.0000; GAAG*CAC
Sequence 1232 in group IL_55516.2 with cutoff score    90.4190 does better against group IL_41344.1 cutoff score   100.0000; GAAG*CAC
Sequence 1232 in group IL_55516.2 with cutoff score    90.4190 does better against group IL_57744.1 cutoff score    92.9639; GAAG*CAC
Sequence 1232 in group IL_55516.2 with cutoff score    90.4190 does better against group IL_90351.1 cutoff score    99.2616; GAAG*CAC
Sequence 1233 in group IL_55516.2 with cutoff score    90.1305 does better against group IL_85599.2 cutoff score    95.4408; GGGG*UAC
Sequence 1233 in group IL_55516.2 with cutoff score    90.1305 does better against group IL_96371.1 cutoff score    99.2404; GGGG*UAC
Sequence 1237 in group IL_55516.2 with cutoff score    56.7343 does better against group IL_59302.1 cutoff score    63.3730; GAACAA*UAC
Sequence 1237 in group IL_55516.2 with cutoff score    56.7343 does better against group IL_98347.1 cutoff score    67.0909; GAACAA*UAC
Sequence 1255 in group IL_56987.1 with cutoff score    94.6551 does better against group IL_15052.4 cutoff score    98.6502; GUAC*GC
Sequence 1255 in group IL_56987.1 with cutoff score    94.6551 does better against group IL_73452.2 cutoff score   100.0000; GUAC*GC
Sequence 1262 in group IL_57744.1 with cutoff score    92.9639 does better against group IL_08770.1 cutoff score    96.8317; GAAG*CAC
Sequence 1262 in group IL_57744.1 with cutoff score    92.9639 does better against group IL_31531.3 cutoff score   100.0000; GAAG*CAC
Sequence 1262 in group IL_57744.1 with cutoff score    92.9639 does better against group IL_41344.1 cutoff score   100.0000; GAAG*CAC
Sequence 1262 in group IL_57744.1 with cutoff score    92.9639 does better against group IL_90351.1 cutoff score    99.2616; GAAG*CAC
Sequence 1266 in group IL_57744.1 with cutoff score    85.9302 does better against group IL_44465.1 cutoff score    86.9095; GGA*UAC
Sequence 1267 in group IL_57744.1 with cutoff score    76.8185 does better against group IL_31737.3 cutoff score    96.5160; UAU*AAA
Sequence 1267 in group IL_57744.1 with cutoff score    76.8185 does better against group IL_42997.3 cutoff score    89.2124; UAU*AAA
Sequence 1267 in group IL_57744.1 with cutoff score    76.8185 does better against group IL_57744.1 cutoff score    77.9634; UAU*AAA
Sequence 1269 in group IL_57744.1 with cutoff score    61.6370 does better against group IL_07785.1 cutoff score    62.4206; GCCG*CAC
Sequence 1269 in group IL_57744.1 with cutoff score    61.6370 does better against group IL_99358.1 cutoff score    89.2617; GCCG*CAC
Sequence 1270 in group IL_57744.1 with cutoff score    69.6037 does better against group IL_31737.3 cutoff score    85.8607; CAG*UAG
Sequence 1271 in group IL_57744.1 with cutoff score    92.9639 does better against group IL_08770.1 cutoff score    96.8317; GAAG*CAC
Sequence 1271 in group IL_57744.1 with cutoff score    92.9639 does better against group IL_31531.3 cutoff score   100.0000; GAAG*CAC
Sequence 1271 in group IL_57744.1 with cutoff score    92.9639 does better against group IL_41344.1 cutoff score   100.0000; GAAG*CAC
Sequence 1271 in group IL_57744.1 with cutoff score    92.9639 does better against group IL_90351.1 cutoff score    99.2616; GAAG*CAC
Sequence 1282 in group IL_57744.1 with cutoff score    56.5358 does better against group IL_07785.1 cutoff score    63.1962; CCG*UAG
Sequence 1282 in group IL_57744.1 with cutoff score    56.5358 does better against group IL_67095.2 cutoff score    89.9576; CCG*UAG
Sequence 1282 in group IL_57744.1 with cutoff score    56.5358 does better against group IL_87907.2 cutoff score    71.9727; CCG*UAG
Sequence 1311 in group IL_59877.1 with cutoff score    91.3022 does better against group IL_76709.2 cutoff score    93.5492; UAUA*UG
Sequence 1320 in group IL_61258.15 with cutoff score    90.8936 does better against group IL_48076.6 cutoff score    91.2724; CCA*UG
Sequence 1320 in group IL_61258.15 with cutoff score    90.8936 does better against group IL_63775.1 cutoff score    99.1269; CCA*UG
Sequence 1321 in group IL_61258.15 with cutoff score    90.8936 does better against group IL_48076.6 cutoff score    91.2724; CCA*UG
Sequence 1321 in group IL_61258.15 with cutoff score    90.8936 does better against group IL_63775.1 cutoff score    99.1269; CCA*UG
Sequence 1322 in group IL_61258.15 with cutoff score    93.1485 does better against group IL_51454.3 cutoff score    94.9482; UCA*UA
Sequence 1323 in group IL_61258.15 with cutoff score    90.8936 does better against group IL_48076.6 cutoff score    91.2724; CCA*UG
Sequence 1323 in group IL_61258.15 with cutoff score    90.8936 does better against group IL_63775.1 cutoff score    99.1269; CCA*UG
Sequence 1330 in group IL_61258.15 with cutoff score    94.5767 does better against group IL_51454.3 cutoff score    96.8135; UCU*AA
Sequence 1344 in group IL_61258.15 with cutoff score    93.1485 does better against group IL_51454.3 cutoff score    94.9482; UCA*UA
Sequence 1350 in group IL_61258.15 with cutoff score    93.1485 does better against group IL_51454.3 cutoff score    94.9482; UCA*UA
Sequence 1355 in group IL_61258.15 with cutoff score    93.1485 does better against group IL_51454.3 cutoff score    94.9482; UCA*UA
Sequence 1356 in group IL_61258.15 with cutoff score    94.7736 does better against group IL_63775.1 cutoff score   100.0000; CCG*CG
Sequence 1357 in group IL_61258.15 with cutoff score    89.6856 does better against group IL_48076.6 cutoff score    95.2383; CCC*GG
Sequence 1357 in group IL_61258.15 with cutoff score    89.6856 does better against group IL_63775.1 cutoff score    99.2157; CCC*GG
Sequence 1360 in group IL_61258.15 with cutoff score    72.7045 does better against group IL_07039.3 cutoff score    82.7439; UCC*GG
Sequence 1360 in group IL_61258.15 with cutoff score    72.7045 does better against group IL_48076.6 cutoff score    91.5079; UCC*GG
Sequence 1360 in group IL_61258.15 with cutoff score    72.7045 does better against group IL_63775.1 cutoff score    77.1027; UCC*GG
Sequence 1365 in group IL_61341.1 with cutoff score    93.6440 does better against group IL_49061.1 cutoff score    96.2406; CGAAG*CAG
Sequence 1371 in group IL_61440.1 with cutoff score   100.0000 does better against group IL_50730.2 cutoff score   100.0000; CGAAG*UGGAG
Sequence 1372 in group IL_61476.2 with cutoff score    89.9207 does better against group IL_49061.1 cutoff score    96.2406; CGAAG*CAG
Sequence 1372 in group IL_61476.2 with cutoff score    89.9207 does better against group IL_61341.1 cutoff score    93.6440; CGAAG*CAG
Sequence 1377 in group IL_61476.2 with cutoff score    99.1296 does better against group IL_25463.1 cutoff score    99.3543; UGUAG*CAA
Sequence 1398 in group IL_63596.11 with cutoff score    55.3230 does better against group IL_28788.1 cutoff score    71.6211; CCAAC*GGG
Sequence 1398 in group IL_63596.11 with cutoff score    55.3230 does better against group IL_57881.1 cutoff score    60.2751; CCAAC*GGG
Sequence 1398 in group IL_63596.11 with cutoff score    55.3230 does better against group IL_83150.2 cutoff score    61.9885; CCAAC*GGG
Sequence 1400 in group IL_63596.11 with cutoff score    55.3451 does better against group IL_28788.1 cutoff score    72.3941; UCAAC*GGA
Sequence 1400 in group IL_63596.11 with cutoff score    55.3451 does better against group IL_57881.1 cutoff score    59.4712; UCAAC*GGA
Sequence 1400 in group IL_63596.11 with cutoff score    55.3451 does better against group IL_83150.2 cutoff score    63.0416; UCAAC*GGA
Sequence 1401 in group IL_63596.11 with cutoff score    55.3451 does better against group IL_28788.1 cutoff score    72.3941; UCAAC*GGA
Sequence 1401 in group IL_63596.11 with cutoff score    55.3451 does better against group IL_57881.1 cutoff score    59.4712; UCAAC*GGA
Sequence 1401 in group IL_63596.11 with cutoff score    55.3451 does better against group IL_83150.2 cutoff score    63.0416; UCAAC*GGA
Sequence 1409 in group IL_64231.5 with cutoff score    79.1084 does better against group IL_65718.4 cutoff score   100.0000; GUAAC*GCCC
Sequence 1410 in group IL_64231.5 with cutoff score    95.8123 does better against group IL_51479.1 cutoff score   100.0000; AAAAG*CGCU
Sequence 1410 in group IL_64231.5 with cutoff score    95.8123 does better against group IL_62012.1 cutoff score   100.0000; AAAAG*CGCU
Sequence 1415 in group IL_64231.5 with cutoff score    95.8123 does better against group IL_51479.1 cutoff score   100.0000; AAAAG*CGCU
Sequence 1415 in group IL_64231.5 with cutoff score    95.8123 does better against group IL_62012.1 cutoff score   100.0000; AAAAG*CGCU
Sequence 1439 in group IL_66635.5 with cutoff score    39.4048 does better against group IL_20031.1 cutoff score    56.0590; AUCUG*CU
Sequence 1439 in group IL_66635.5 with cutoff score    39.4048 does better against group IL_94967.1 cutoff score    55.1994; AUCUG*CU
Sequence 1440 in group IL_66635.5 with cutoff score    88.0921 does better against group IL_50694.7 cutoff score   100.0000; GGAC*GC
Sequence 1441 in group IL_66635.5 with cutoff score    86.1525 does better against group IL_76709.2 cutoff score    98.9466; AAUG*CU
Sequence 1441 in group IL_66635.5 with cutoff score    86.1525 does better against group IL_79895.1 cutoff score    97.9481; AAUG*CU
Sequence 1442 in group IL_66635.5 with cutoff score    90.8075 does better against group IL_76709.2 cutoff score    99.6447; GAUG*CC
Sequence 1442 in group IL_66635.5 with cutoff score    90.8075 does better against group IL_79895.1 cutoff score    99.2828; GAUG*CC
Sequence 1444 in group IL_66635.5 with cutoff score    88.9763 does better against group IL_56987.1 cutoff score    98.7852; AUUG*CU
Sequence 1444 in group IL_66635.5 with cutoff score    88.9763 does better against group IL_84476.1 cutoff score    97.2046; AUUG*CU
Sequence 1445 in group IL_66635.5 with cutoff score    81.1846 does better against group IL_82107.4 cutoff score    87.0532; UGAA*UG
Sequence 1446 in group IL_66635.5 with cutoff score    78.5251 does better against group IL_42626.2 cutoff score    87.8259; GUCG*CC
Sequence 1446 in group IL_66635.5 with cutoff score    78.5251 does better against group IL_79895.1 cutoff score    99.2828; GUCG*CC
Sequence 1447 in group IL_66635.5 with cutoff score    97.0110 does better against group IL_50694.7 cutoff score   100.0000; GGUC*GC
Sequence 1448 in group IL_66635.5 with cutoff score    75.3723 does better against group IL_42626.2 cutoff score    87.8259; GCUG*CC
Sequence 1449 in group IL_66635.5 with cutoff score    95.9657 does better against group IL_00225.13 cutoff score   100.0000; UGC*GG
Sequence 1449 in group IL_66635.5 with cutoff score    95.9657 does better against group IL_07039.3 cutoff score    97.0864; UGC*GG
Sequence 1450 in group IL_66635.5 with cutoff score    85.2189 does better against group IL_50694.7 cutoff score    93.7484; GGAA*UC
Sequence 1451 in group IL_66635.5 with cutoff score    93.6313 does better against group IL_56987.1 cutoff score   100.0000; GUUG*CC
Sequence 1451 in group IL_66635.5 with cutoff score    93.6313 does better against group IL_84476.1 cutoff score   100.0000; GUUG*CC
Sequence 1453 in group IL_66635.5 with cutoff score    93.6313 does better against group IL_56987.1 cutoff score   100.0000; GUUG*CC
Sequence 1453 in group IL_66635.5 with cutoff score    93.6313 does better against group IL_84476.1 cutoff score   100.0000; GUUG*CC
Sequence 1454 in group IL_66635.5 with cutoff score    95.9657 does better against group IL_00225.13 cutoff score   100.0000; UGC*GG
Sequence 1454 in group IL_66635.5 with cutoff score    95.9657 does better against group IL_07039.3 cutoff score    97.0864; UGC*GG
Sequence 1455 in group IL_66635.5 with cutoff score    93.6313 does better against group IL_56987.1 cutoff score   100.0000; GUUG*CC
Sequence 1455 in group IL_66635.5 with cutoff score    93.6313 does better against group IL_84476.1 cutoff score   100.0000; GUUG*CC
Sequence 1456 in group IL_66635.5 with cutoff score    89.0823 does better against group IL_07039.3 cutoff score    93.4870; UAC*GG
Sequence 1456 in group IL_66635.5 with cutoff score    89.0823 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence 1456 in group IL_66635.5 with cutoff score    89.0823 does better against group IL_48076.6 cutoff score    96.2696; UAC*GG
Sequence 1458 in group IL_66635.5 with cutoff score    93.6313 does better against group IL_56987.1 cutoff score   100.0000; GUUG*CC
Sequence 1458 in group IL_66635.5 with cutoff score    93.6313 does better against group IL_84476.1 cutoff score   100.0000; GUUG*CC
Sequence 1459 in group IL_66635.5 with cutoff score    89.0823 does better against group IL_07039.3 cutoff score    93.4870; UAC*GG
Sequence 1459 in group IL_66635.5 with cutoff score    89.0823 does better against group IL_33761.2 cutoff score    98.2651; UAC*GG
Sequence 1459 in group IL_66635.5 with cutoff score    89.0823 does better against group IL_48076.6 cutoff score    96.2696; UAC*GG
Sequence 1460 in group IL_66635.5 with cutoff score    95.4801 does better against group IL_00225.13 cutoff score    99.4453; CGC*GG
Sequence 1460 in group IL_66635.5 with cutoff score    95.4801 does better against group IL_16386.4 cutoff score    97.8877; CGC*GG
Sequence 1461 in group IL_66635.5 with cutoff score    81.1846 does better against group IL_82107.4 cutoff score    87.0532; UGAA*UG
Sequence 1462 in group IL_66635.5 with cutoff score    96.6455 does better against group IL_07039.3 cutoff score   100.0000; UGG*CG
Sequence 1463 in group IL_66635.5 with cutoff score    95.4801 does better against group IL_00225.13 cutoff score    99.4453; CGC*GG
Sequence 1463 in group IL_66635.5 with cutoff score    95.4801 does better against group IL_16386.4 cutoff score    97.8877; CGC*GG
Sequence 1464 in group IL_66635.5 with cutoff score    80.7020 does better against group IL_82107.4 cutoff score    87.8013; UGAU*AG
Sequence 1465 in group IL_66635.5 with cutoff score    84.0325 does better against group IL_15052.4 cutoff score    98.6502; GUAC*GC
Sequence 1465 in group IL_66635.5 with cutoff score    84.0325 does better against group IL_56987.1 cutoff score    94.6551; GUAC*GC
Sequence 1465 in group IL_66635.5 with cutoff score    84.0325 does better against group IL_68140.4 cutoff score    93.4368; GUAC*GC
Sequence 1465 in group IL_66635.5 with cutoff score    84.0325 does better against group IL_73452.2 cutoff score   100.0000; GUAC*GC
Sequence 1465 in group IL_66635.5 with cutoff score    84.0325 does better against group IL_82107.4 cutoff score    85.2486; GUAC*GC
Sequence 1472 in group IL_66798.2 with cutoff score    84.7262 does better against group IL_50730.2 cutoff score    98.2958; CGAAU*AGGAG
Sequence 1482 in group IL_67095.2 with cutoff score    46.0844 does better against group IL_55516.2 cutoff score    60.9852; UAG*CAGG
Sequence 1482 in group IL_67095.2 with cutoff score    46.0844 does better against group IL_57744.1 cutoff score    69.6327; UAG*CAGG
Sequence 1482 in group IL_67095.2 with cutoff score    46.0844 does better against group IL_85599.2 cutoff score    59.7489; UAG*CAGG
Sequence 1492 in group IL_68140.4 with cutoff score    93.8125 does better against group IL_15052.4 cutoff score   100.0000; AAAC*GU
Sequence 1492 in group IL_68140.4 with cutoff score    93.8125 does better against group IL_73355.1 cutoff score    98.5299; AAAC*GU
Sequence 1492 in group IL_68140.4 with cutoff score    93.8125 does better against group IL_76709.2 cutoff score    94.6229; AAAC*GU
Sequence 1493 in group IL_68140.4 with cutoff score    93.8125 does better against group IL_15052.4 cutoff score   100.0000; AAAC*GU
Sequence 1493 in group IL_68140.4 with cutoff score    93.8125 does better against group IL_73355.1 cutoff score    98.5299; AAAC*GU
Sequence 1493 in group IL_68140.4 with cutoff score    93.8125 does better against group IL_76709.2 cutoff score    94.6229; AAAC*GU
Sequence 1494 in group IL_68140.4 with cutoff score    88.7968 does better against group IL_56987.1 cutoff score    93.3665; AUAC*GU
Sequence 1494 in group IL_68140.4 with cutoff score    88.7968 does better against group IL_73452.2 cutoff score    98.7114; AUAC*GU
Sequence 1495 in group IL_68140.4 with cutoff score    88.2663 does better against group IL_56987.1 cutoff score    92.6921; AUAU*AU
Sequence 1495 in group IL_68140.4 with cutoff score    88.2663 does better against group IL_73452.2 cutoff score    97.9392; AUAU*AU
Sequence 1496 in group IL_68140.4 with cutoff score    88.7968 does better against group IL_56987.1 cutoff score    93.3665; AUAC*GU
Sequence 1496 in group IL_68140.4 with cutoff score    88.7968 does better against group IL_73452.2 cutoff score    98.7114; AUAC*GU
Sequence 1497 in group IL_68140.4 with cutoff score    88.7968 does better against group IL_56987.1 cutoff score    93.3665; AUAC*GU
Sequence 1497 in group IL_68140.4 with cutoff score    88.7968 does better against group IL_73452.2 cutoff score    98.7114; AUAC*GU
Sequence 1507 in group IL_68140.4 with cutoff score    92.9062 does better against group IL_15052.4 cutoff score    96.6510; GUAU*AC
Sequence 1507 in group IL_68140.4 with cutoff score    92.9062 does better against group IL_56987.1 cutoff score    93.9807; GUAU*AC
Sequence 1507 in group IL_68140.4 with cutoff score    92.9062 does better against group IL_73452.2 cutoff score    99.2278; GUAU*AC
Sequence 1508 in group IL_68140.4 with cutoff score    90.9171 does better against group IL_00881.1 cutoff score    94.6180; CAAG*CG
Sequence 1508 in group IL_68140.4 with cutoff score    90.9171 does better against group IL_15052.4 cutoff score    94.2893; CAAG*CG
Sequence 1508 in group IL_68140.4 with cutoff score    90.9171 does better against group IL_73355.1 cutoff score    98.7544; CAAG*CG
Sequence 1508 in group IL_68140.4 with cutoff score    90.9171 does better against group IL_76709.2 cutoff score    92.9234; CAAG*CG
Sequence 1508 in group IL_68140.4 with cutoff score    90.9171 does better against group IL_81831.1 cutoff score    92.1199; CAAG*CG
Sequence 1508 in group IL_68140.4 with cutoff score    90.9171 does better against group IL_82107.4 cutoff score    96.2397; CAAG*CG
Sequence 1514 in group IL_68574.4 with cutoff score    78.7249 does better against group IL_64231.5 cutoff score    90.2079; CACC*GCAAG
Sequence 1533 in group IL_69229.3 with cutoff score    74.7782 does better against group IL_94910.1 cutoff score    95.4938; CGUUUGACG*CCGAG
Sequence 1534 in group IL_69229.3 with cutoff score    82.8100 does better against group IL_70923.9 cutoff score    84.4261; CGUUGAAA*UGGAG
Sequence 1575 in group IL_70923.9 with cutoff score    82.0383 does better against group IL_01488.3 cutoff score    94.1790; AGACGAUC*GGGAU
Sequence 1583 in group IL_70923.9 with cutoff score    64.7315 does better against group IL_94910.1 cutoff score   100.0000; UGAUGACC*GCAAG
Sequence 1594 in group IL_73452.2 with cutoff score    97.9089 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 1594 in group IL_73452.2 with cutoff score    97.9089 does better against group IL_89505.4 cutoff score    98.6290; GUC*GC
Sequence 1615 in group IL_76308.6 with cutoff score    96.3202 does better against group IL_71294.3 cutoff score   100.0000; CCAGGU*GAGCAG
Sequence 1623 in group IL_76709.2 with cutoff score    94.2676 does better against group IL_68140.4 cutoff score   100.0000; GAAG*CC
Sequence 1623 in group IL_76709.2 with cutoff score    94.2676 does better against group IL_73355.1 cutoff score    97.5087; GAAG*CC
Sequence 1623 in group IL_76709.2 with cutoff score    94.2676 does better against group IL_82107.4 cutoff score    94.5457; GAAG*CC
Sequence 1651 in group IL_77658.1 with cutoff score    82.6273 does better against group IL_77658.1 cutoff score    82.6636; CUUC*GUCG
Sequence 1654 in group IL_77658.1 with cutoff score    82.6273 does better against group IL_77658.1 cutoff score    82.6636; CUUC*GUCG
Sequence 1658 in group IL_77658.1 with cutoff score    94.0554 does better against group IL_77658.1 cutoff score    96.1388; CUUA*UUUG
Sequence 1667 in group IL_77658.1 with cutoff score    23.6210 does better against group IL_22373.1 cutoff score    29.6572; AGUUC*GUCU
Sequence 1667 in group IL_77658.1 with cutoff score    23.6210 does better against group IL_26728.3 cutoff score    41.2951; AGUUC*GUCU
Sequence 1689 in group IL_80231.1 with cutoff score    93.0478 does better against group IL_59258.1 cutoff score   100.0000; GAUGAAA*UAACC
Sequence 1715 in group IL_81831.1 with cutoff score    92.7026 does better against group IL_00881.1 cutoff score    93.2835; UAAG*CA
Sequence 1715 in group IL_81831.1 with cutoff score    92.7026 does better against group IL_15052.4 cutoff score    98.0405; UAAG*CA
Sequence 1715 in group IL_81831.1 with cutoff score    92.7026 does better against group IL_73355.1 cutoff score    97.4199; UAAG*CA
Sequence 1715 in group IL_81831.1 with cutoff score    92.7026 does better against group IL_76709.2 cutoff score    93.5148; UAAG*CA
Sequence 1715 in group IL_81831.1 with cutoff score    92.7026 does better against group IL_82107.4 cutoff score    95.0244; UAAG*CA
Sequence 1717 in group IL_82107.4 with cutoff score    81.4782 does better against group IL_42626.2 cutoff score    91.6957; AC*GACU
Sequence 1717 in group IL_82107.4 with cutoff score    81.4782 does better against group IL_76709.2 cutoff score    93.5760; AC*GACU
Sequence 1718 in group IL_82107.4 with cutoff score    81.4782 does better against group IL_42626.2 cutoff score    91.6957; AC*GACU
Sequence 1718 in group IL_82107.4 with cutoff score    81.4782 does better against group IL_76709.2 cutoff score    93.5760; AC*GACU
Sequence 1719 in group IL_82107.4 with cutoff score    87.0723 does better against group IL_47074.2 cutoff score    99.4084; GG*UAGC
Sequence 1719 in group IL_82107.4 with cutoff score    87.0723 does better against group IL_95583.2 cutoff score    88.3158; GG*UAGC
Sequence 1720 in group IL_82107.4 with cutoff score    87.0723 does better against group IL_47074.2 cutoff score    99.4084; GG*UAGC
Sequence 1720 in group IL_82107.4 with cutoff score    87.0723 does better against group IL_95583.2 cutoff score    88.3158; GG*UAGC
Sequence 1722 in group IL_82107.4 with cutoff score    81.4782 does better against group IL_42626.2 cutoff score    91.6957; AC*GACU
Sequence 1722 in group IL_82107.4 with cutoff score    81.4782 does better against group IL_76709.2 cutoff score    93.5760; AC*GACU
Sequence 1723 in group IL_82107.4 with cutoff score    85.3040 does better against group IL_42626.2 cutoff score    89.5885; CG*CUAG
Sequence 1723 in group IL_82107.4 with cutoff score    85.3040 does better against group IL_56987.1 cutoff score    94.1352; CG*CUAG
Sequence 1723 in group IL_82107.4 with cutoff score    85.3040 does better against group IL_68140.4 cutoff score    85.9015; CG*CUAG
Sequence 1723 in group IL_82107.4 with cutoff score    85.3040 does better against group IL_73452.2 cutoff score   100.0000; CG*CUAG
Sequence 1726 in group IL_82107.4 with cutoff score    78.1477 does better against group IL_66635.5 cutoff score    88.9171; GG*UUUC
Sequence 1728 in group IL_82107.4 with cutoff score    78.1477 does better against group IL_66635.5 cutoff score    88.9171; GG*UUUC
Sequence 1729 in group IL_82107.4 with cutoff score    98.6074 does better against group IL_73355.1 cutoff score    98.6655; AG*CAAU
Sequence 1730 in group IL_82107.4 with cutoff score    98.6074 does better against group IL_73355.1 cutoff score    98.6655; AG*CAAU
Sequence 1732 in group IL_82107.4 with cutoff score    70.5425 does better against group IL_42626.2 cutoff score    82.2437; AC*GUCU
Sequence 1732 in group IL_82107.4 with cutoff score    70.5425 does better against group IL_66635.5 cutoff score    74.4895; AC*GUCU
Sequence 1732 in group IL_82107.4 with cutoff score    70.5425 does better against group IL_79895.1 cutoff score    99.9959; AC*GUCU
Sequence 1734 in group IL_82107.4 with cutoff score    97.8593 does better against group IL_73355.1 cutoff score    98.5299; UG*CAAA
Sequence 1736 in group IL_82107.4 with cutoff score    84.9124 does better against group IL_50694.7 cutoff score    92.7188; UG*CGAA
Sequence 1737 in group IL_82107.4 with cutoff score    72.3572 does better against group IL_66635.5 cutoff score    93.1710; CG*CGUG
Sequence 1738 in group IL_82107.4 with cutoff score    85.3040 does better against group IL_59877.1 cutoff score    97.5541; CG*CAUG
Sequence 1738 in group IL_82107.4 with cutoff score    85.3040 does better against group IL_66635.5 cutoff score    86.2876; CG*CAUG
Sequence 1738 in group IL_82107.4 with cutoff score    85.3040 does better against group IL_76709.2 cutoff score    98.3005; CG*CAUG
Sequence 1738 in group IL_82107.4 with cutoff score    85.3040 does better against group IL_79895.1 cutoff score    98.0369; CG*CAUG
Sequence 1740 in group IL_82107.4 with cutoff score    96.9133 does better against group IL_68140.4 cutoff score    97.9219; AC*GAAU
Sequence 1740 in group IL_82107.4 with cutoff score    96.9133 does better against group IL_73355.1 cutoff score    97.4199; AC*GAAU
Sequence 1741 in group IL_82107.4 with cutoff score    84.9316 does better against group IL_15052.4 cutoff score    96.5439; GG*CAGC
Sequence 1741 in group IL_82107.4 with cutoff score    84.9316 does better against group IL_95583.2 cutoff score    93.7099; GG*CAGC
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_07785.1 cutoff score    89.0808; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_08770.1 cutoff score    94.7363; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_10167.6 cutoff score    44.6762; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_14688.1 cutoff score    99.4942; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_28037.2 cutoff score    58.3736; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_31737.3 cutoff score    40.7792; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_42771.1 cutoff score    40.9520; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_42997.3 cutoff score    34.1116; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_57744.1 cutoff score    28.1565; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_61341.1 cutoff score    37.0766; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_67095.2 cutoff score    31.3940; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_83389.2 cutoff score    22.8643; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_87907.2 cutoff score    75.7006; ACU*AUU
Sequence 1743 in group IL_82107.4 with cutoff score    19.3668 does better against group IL_99358.1 cutoff score    21.0155; ACU*AUU
Sequence 1744 in group IL_82107.4 with cutoff score    78.1477 does better against group IL_66635.5 cutoff score    88.9171; GG*UUUC
Sequence 1745 in group IL_82107.4 with cutoff score    53.4460 does better against group IL_41344.1 cutoff score    56.8763; GAA*UAGC
Sequence 1745 in group IL_82107.4 with cutoff score    53.4460 does better against group IL_57744.1 cutoff score    78.3595; GAA*UAGC
Sequence 1745 in group IL_82107.4 with cutoff score    53.4460 does better against group IL_67095.2 cutoff score    54.6703; GAA*UAGC
Sequence 1745 in group IL_82107.4 with cutoff score    53.4460 does better against group IL_90351.1 cutoff score    65.0145; GAA*UAGC
Sequence 1746 in group IL_82107.4 with cutoff score    53.4460 does better against group IL_41344.1 cutoff score    56.8763; GAA*UAGC
Sequence 1746 in group IL_82107.4 with cutoff score    53.4460 does better against group IL_57744.1 cutoff score    78.3595; GAA*UAGC
Sequence 1746 in group IL_82107.4 with cutoff score    53.4460 does better against group IL_67095.2 cutoff score    54.6703; GAA*UAGC
Sequence 1746 in group IL_82107.4 with cutoff score    53.4460 does better against group IL_90351.1 cutoff score    65.0145; GAA*UAGC
Sequence 1771 in group IL_82741.2 with cutoff score    73.9992 does better against group IL_20031.1 cutoff score    99.9946; CCCUU*AG
Sequence 1786 in group IL_84251.1 with cutoff score    75.5058 does better against group IL_71598.1 cutoff score    82.6797; CAAG*CGAAG
Sequence 1790 in group IL_84476.1 with cutoff score    84.9642 does better against group IL_42626.2 cutoff score    89.5885; CG*CUAG
Sequence 1790 in group IL_84476.1 with cutoff score    84.9642 does better against group IL_56987.1 cutoff score    94.1352; CG*CUAG
Sequence 1790 in group IL_84476.1 with cutoff score    84.9642 does better against group IL_68140.4 cutoff score    85.9015; CG*CUAG
Sequence 1790 in group IL_84476.1 with cutoff score    84.9642 does better against group IL_73452.2 cutoff score   100.0000; CG*CUAG
Sequence 1790 in group IL_84476.1 with cutoff score    84.9642 does better against group IL_82107.4 cutoff score    85.3040; CG*CUAG
Sequence 1792 in group IL_84476.1 with cutoff score    84.9642 does better against group IL_42626.2 cutoff score    89.5885; CG*CUAG
Sequence 1792 in group IL_84476.1 with cutoff score    84.9642 does better against group IL_56987.1 cutoff score    94.1352; CG*CUAG
Sequence 1792 in group IL_84476.1 with cutoff score    84.9642 does better against group IL_68140.4 cutoff score    85.9015; CG*CUAG
Sequence 1792 in group IL_84476.1 with cutoff score    84.9642 does better against group IL_73452.2 cutoff score   100.0000; CG*CUAG
Sequence 1792 in group IL_84476.1 with cutoff score    84.9642 does better against group IL_82107.4 cutoff score    85.3040; CG*CUAG
Sequence 1794 in group IL_84476.1 with cutoff score    63.7788 does better against group IL_15052.4 cutoff score    66.2340; CUAG*CG
Sequence 1794 in group IL_84476.1 with cutoff score    63.7788 does better against group IL_42626.2 cutoff score    89.5885; CUAG*CG
Sequence 1794 in group IL_84476.1 with cutoff score    63.7788 does better against group IL_56987.1 cutoff score    94.1352; CUAG*CG
Sequence 1794 in group IL_84476.1 with cutoff score    63.7788 does better against group IL_66635.5 cutoff score    80.1925; CUAG*CG
Sequence 1794 in group IL_84476.1 with cutoff score    63.7788 does better against group IL_68140.4 cutoff score    85.9015; CUAG*CG
Sequence 1794 in group IL_84476.1 with cutoff score    63.7788 does better against group IL_73452.2 cutoff score   100.0000; CUAG*CG
Sequence 1794 in group IL_84476.1 with cutoff score    63.7788 does better against group IL_82107.4 cutoff score    85.3040; CUAG*CG
Sequence 1794 in group IL_84476.1 with cutoff score    63.7788 does better against group IL_84476.1 cutoff score    84.9642; CUAG*CG
Sequence 1795 in group IL_84476.1 with cutoff score    52.5471 does better against group IL_94967.1 cutoff score    56.0725; GUUCG*CC
Sequence 1796 in group IL_84476.1 with cutoff score    52.5471 does better against group IL_94967.1 cutoff score    56.0725; GUUCG*CC
Sequence 1797 in group IL_84476.1 with cutoff score    65.6894 does better against group IL_42626.2 cutoff score    82.4497; GCUC*GC
Sequence 1797 in group IL_84476.1 with cutoff score    65.6894 does better against group IL_66635.5 cutoff score    74.6925; GCUC*GC
Sequence 1798 in group IL_84476.1 with cutoff score    82.2027 does better against group IL_66635.5 cutoff score    86.7718; AC*GAUU
Sequence 1798 in group IL_84476.1 with cutoff score    82.2027 does better against group IL_76709.2 cutoff score    98.9531; AC*GAUU
Sequence 1798 in group IL_84476.1 with cutoff score    82.2027 does better against group IL_79895.1 cutoff score    99.9959; AC*GAUU
Sequence 1798 in group IL_84476.1 with cutoff score    82.2027 does better against group IL_82107.4 cutoff score    85.9776; AC*GAUU
Sequence 1799 in group IL_84476.1 with cutoff score    97.2046 does better against group IL_56987.1 cutoff score    98.7852; CU*AUUG
Sequence 1800 in group IL_84476.1 with cutoff score    49.1697 does better against group IL_02555.1 cutoff score    50.3268; CGAC*GG
Sequence 1800 in group IL_84476.1 with cutoff score    49.1697 does better against group IL_33761.2 cutoff score    85.6652; CGAC*GG
Sequence 1800 in group IL_84476.1 with cutoff score    49.1697 does better against group IL_50694.7 cutoff score   100.0000; CGAC*GG
Sequence 1800 in group IL_84476.1 with cutoff score    49.1697 does better against group IL_66635.5 cutoff score    83.5722; CGAC*GG
Sequence 1800 in group IL_84476.1 with cutoff score    49.1697 does better against group IL_73355.1 cutoff score    51.4796; CGAC*GG
Sequence 1800 in group IL_84476.1 with cutoff score    49.1697 does better against group IL_73452.2 cutoff score    56.2952; CGAC*GG
Sequence 1800 in group IL_84476.1 with cutoff score    49.1697 does better against group IL_82107.4 cutoff score    84.9316; CGAC*GG
Sequence 1811 in group IL_85033.2 with cutoff score    57.4948 does better against group IL_04785.1 cutoff score    86.4627; CCCG*CCCG
Sequence 1811 in group IL_85033.2 with cutoff score    57.4948 does better against group IL_43644.1 cutoff score    92.8325; CCCG*CCCG
Sequence 1811 in group IL_85033.2 with cutoff score    57.4948 does better against group IL_84251.1 cutoff score    93.8695; CCCG*CCCG
Sequence 1813 in group IL_85033.2 with cutoff score    68.4650 does better against group IL_77658.1 cutoff score    71.7571; CCUG*CCUG
Sequence 1814 in group IL_85033.2 with cutoff score    78.8631 does better against group IL_51479.1 cutoff score    79.5495; GUUC*GUUC
Sequence 1814 in group IL_85033.2 with cutoff score    78.8631 does better against group IL_77658.1 cutoff score    92.0174; GUUC*GUUC
Sequence 1819 in group IL_85033.2 with cutoff score    63.2217 does better against group IL_77658.1 cutoff score    68.2128; AUUU*GUUU
Sequence 1822 in group IL_85033.2 with cutoff score    54.5049 does better against group IL_25872.4 cutoff score    85.1266; CGGG*CGGG
Sequence 1825 in group IL_85033.2 with cutoff score    75.1009 does better against group IL_92446.2 cutoff score    76.4070; UACA*UUGA
Sequence 1828 in group IL_85033.2 with cutoff score    75.1009 does better against group IL_92446.2 cutoff score    76.4070; UACA*UUGA
Sequence 1852 in group IL_85599.2 with cutoff score    98.5345 does better against group IL_96371.1 cutoff score   100.0000; UAG*CGGG
Sequence 1854 in group IL_85599.2 with cutoff score    98.5345 does better against group IL_96371.1 cutoff score   100.0000; UAG*CGGG
Sequence 1869 in group IL_87907.2 with cutoff score    94.8534 does better against group IL_67095.2 cutoff score    96.4657; GAC*GCC
Sequence 1870 in group IL_87907.2 with cutoff score    89.6512 does better against group IL_67095.2 cutoff score    97.0584; AAC*GCU
Sequence 1871 in group IL_87907.2 with cutoff score    89.6512 does better against group IL_67095.2 cutoff score    97.0584; AAC*GCU
Sequence 1872 in group IL_87907.2 with cutoff score    89.6512 does better against group IL_67095.2 cutoff score    97.0584; AAC*GCU
Sequence 1873 in group IL_87907.2 with cutoff score    89.6512 does better against group IL_67095.2 cutoff score    97.0584; AAC*GCU
Sequence 1875 in group IL_87907.2 with cutoff score    96.3378 does better against group IL_67095.2 cutoff score    98.5473; GAG*CCC
Sequence 1876 in group IL_87907.2 with cutoff score    94.8534 does better against group IL_67095.2 cutoff score    96.4657; GAC*GCC
Sequence 1879 in group IL_87907.2 with cutoff score    96.3378 does better against group IL_67095.2 cutoff score    98.5473; GAG*CCC
Sequence 1882 in group IL_87907.2 with cutoff score    96.3378 does better against group IL_67095.2 cutoff score    98.5473; GAG*CCC
Sequence 1883 in group IL_87907.2 with cutoff score    84.4824 does better against group IL_67095.2 cutoff score    96.9940; AAU*ACU
Sequence 1890 in group IL_87907.2 with cutoff score    85.2995 does better against group IL_67095.2 cutoff score    98.5435; GAA*UCC
Sequence 1894 in group IL_87907.2 with cutoff score    84.4824 does better against group IL_67095.2 cutoff score    96.9940; AAU*ACU
Sequence 1898 in group IL_87907.2 with cutoff score    96.3378 does better against group IL_67095.2 cutoff score    98.5473; GAG*CCC
Sequence 1900 in group IL_87907.2 with cutoff score    77.3478 does better against group IL_67095.2 cutoff score    79.2475; GAG*CCU
Sequence 1904 in group IL_87907.2 with cutoff score    76.9987 does better against group IL_07785.1 cutoff score    97.3435; UUA*UUA
Sequence 1904 in group IL_87907.2 with cutoff score    76.9987 does better against group IL_28037.2 cutoff score    83.0305; UUA*UUA
Sequence 1904 in group IL_87907.2 with cutoff score    76.9987 does better against group IL_42771.1 cutoff score    96.7724; UUA*UUA
Sequence 1904 in group IL_87907.2 with cutoff score    76.9987 does better against group IL_42997.3 cutoff score    78.1070; UUA*UUA
Sequence 1905 in group IL_87907.2 with cutoff score    89.6846 does better against group IL_67095.2 cutoff score    96.4012; GAU*ACC
Sequence 1908 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1908 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1911 in group IL_87907.2 with cutoff score    84.4824 does better against group IL_67095.2 cutoff score    96.9940; AAU*ACU
Sequence 1922 in group IL_87907.2 with cutoff score    85.4079 does better against group IL_87907.2 cutoff score    86.4599; ACG*CCU
Sequence 1923 in group IL_87907.2 with cutoff score    85.4079 does better against group IL_87907.2 cutoff score    86.4599; ACG*CCU
Sequence 1924 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1924 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1925 in group IL_87907.2 with cutoff score    96.3378 does better against group IL_67095.2 cutoff score    98.5473; GAG*CCC
Sequence 1929 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1929 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1930 in group IL_87907.2 with cutoff score    96.3378 does better against group IL_67095.2 cutoff score    98.5473; GAG*CCC
Sequence 1933 in group IL_87907.2 with cutoff score    68.1006 does better against group IL_08770.1 cutoff score    73.1645; UCG*CAA
Sequence 1933 in group IL_87907.2 with cutoff score    68.1006 does better against group IL_42997.3 cutoff score    79.2355; UCG*CAA
Sequence 1933 in group IL_87907.2 with cutoff score    68.1006 does better against group IL_57744.1 cutoff score    68.2826; UCG*CAA
Sequence 1933 in group IL_87907.2 with cutoff score    68.1006 does better against group IL_67095.2 cutoff score    98.5976; UCG*CAA
Sequence 1933 in group IL_87907.2 with cutoff score    68.1006 does better against group IL_87907.2 cutoff score    87.8025; UCG*CAA
Sequence 1935 in group IL_87907.2 with cutoff score    51.7111 does better against group IL_42997.3 cutoff score    53.1469; UCC*GAG
Sequence 1935 in group IL_87907.2 with cutoff score    51.7111 does better against group IL_67095.2 cutoff score    79.5956; UCC*GAG
Sequence 1935 in group IL_87907.2 with cutoff score    51.7111 does better against group IL_87907.2 cutoff score    65.4842; UCC*GAG
Sequence 1938 in group IL_87907.2 with cutoff score    73.4103 does better against group IL_42997.3 cutoff score    77.4091; CCU*AAG
Sequence 1938 in group IL_87907.2 with cutoff score    73.4103 does better against group IL_67095.2 cutoff score    99.1400; CCU*AAG
Sequence 1938 in group IL_87907.2 with cutoff score    73.4103 does better against group IL_87907.2 cutoff score    91.1356; CCU*AAG
Sequence 1940 in group IL_87907.2 with cutoff score    74.3695 does better against group IL_07785.1 cutoff score    77.0425; ACA*UCU
Sequence 1940 in group IL_87907.2 with cutoff score    74.3695 does better against group IL_87907.2 cutoff score    74.4969; ACA*UCU
Sequence 1943 in group IL_87907.2 with cutoff score    77.0226 does better against group IL_07785.1 cutoff score    78.1321; GUC*GUU
Sequence 1943 in group IL_87907.2 with cutoff score    77.0226 does better against group IL_87907.2 cutoff score    77.5329; GUC*GUU
Sequence 1946 in group IL_87907.2 with cutoff score    71.3155 does better against group IL_07785.1 cutoff score    89.6595; AUA*UCU
Sequence 1946 in group IL_87907.2 with cutoff score    71.3155 does better against group IL_08770.1 cutoff score    93.5634; AUA*UCU
Sequence 1946 in group IL_87907.2 with cutoff score    71.3155 does better against group IL_14688.1 cutoff score    99.2335; AUA*UCU
Sequence 1947 in group IL_87907.2 with cutoff score    89.6846 does better against group IL_67095.2 cutoff score    96.4012; GAU*ACC
Sequence 1948 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1948 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1949 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1949 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1950 in group IL_87907.2 with cutoff score    70.1118 does better against group IL_07785.1 cutoff score    76.7139; UCA*UCA
Sequence 1950 in group IL_87907.2 with cutoff score    70.1118 does better against group IL_10796.1 cutoff score    71.0766; UCA*UCA
Sequence 1951 in group IL_87907.2 with cutoff score    51.7111 does better against group IL_42997.3 cutoff score    53.1469; UCC*GAG
Sequence 1951 in group IL_87907.2 with cutoff score    51.7111 does better against group IL_67095.2 cutoff score    79.5956; UCC*GAG
Sequence 1951 in group IL_87907.2 with cutoff score    51.7111 does better against group IL_87907.2 cutoff score    65.4842; UCC*GAG
Sequence 1952 in group IL_87907.2 with cutoff score    77.0226 does better against group IL_07785.1 cutoff score    78.1321; GUC*GUU
Sequence 1952 in group IL_87907.2 with cutoff score    77.0226 does better against group IL_87907.2 cutoff score    77.5329; GUC*GUU
Sequence 1953 in group IL_87907.2 with cutoff score    79.0207 does better against group IL_07785.1 cutoff score    90.6883; CUA*UCG
Sequence 1953 in group IL_87907.2 with cutoff score    79.0207 does better against group IL_08770.1 cutoff score    95.8246; CUA*UCG
Sequence 1953 in group IL_87907.2 with cutoff score    79.0207 does better against group IL_14688.1 cutoff score    97.4098; CUA*UCG
Sequence 1954 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_07785.1 cutoff score    92.9769; CUG*CCG
Sequence 1954 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_08770.1 cutoff score    96.4582; CUG*CCG
Sequence 1954 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_14688.1 cutoff score    97.0637; CUG*CCG
Sequence 1955 in group IL_87907.2 with cutoff score    59.7917 does better against group IL_07785.1 cutoff score    70.1195; GCU*GUC
Sequence 1955 in group IL_87907.2 with cutoff score    59.7917 does better against group IL_08770.1 cutoff score    72.2774; GCU*GUC
Sequence 1955 in group IL_87907.2 with cutoff score    59.7917 does better against group IL_14688.1 cutoff score    82.3936; GCU*GUC
Sequence 1955 in group IL_87907.2 with cutoff score    59.7917 does better against group IL_87907.2 cutoff score    67.0816; GCU*GUC
Sequence 1956 in group IL_87907.2 with cutoff score    84.4824 does better against group IL_67095.2 cutoff score    96.9940; AAU*ACU
Sequence 1957 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1957 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1959 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1959 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1960 in group IL_87907.2 with cutoff score    66.2990 does better against group IL_57744.1 cutoff score    72.9478; CGU*GAG
Sequence 1960 in group IL_87907.2 with cutoff score    66.2990 does better against group IL_87907.2 cutoff score    70.9901; CGU*GAG
Sequence 1961 in group IL_87907.2 with cutoff score    86.0716 does better against group IL_07785.1 cutoff score    91.9738; GUC*GCC
Sequence 1961 in group IL_87907.2 with cutoff score    86.0716 does better against group IL_08770.1 cutoff score    94.9412; GUC*GCC
Sequence 1961 in group IL_87907.2 with cutoff score    86.0716 does better against group IL_14688.1 cutoff score   100.0000; GUC*GCC
Sequence 1962 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_07785.1 cutoff score    92.9769; CUG*CCG
Sequence 1962 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_08770.1 cutoff score    96.4582; CUG*CCG
Sequence 1962 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_14688.1 cutoff score    97.0637; CUG*CCG
Sequence 1963 in group IL_87907.2 with cutoff score    92.1876 does better against group IL_67095.2 cutoff score    96.4554; CAU*ACG
Sequence 1964 in group IL_87907.2 with cutoff score    84.4824 does better against group IL_67095.2 cutoff score    96.9940; AAU*ACU
Sequence 1965 in group IL_87907.2 with cutoff score    86.0716 does better against group IL_07785.1 cutoff score    91.9738; GUC*GCC
Sequence 1965 in group IL_87907.2 with cutoff score    86.0716 does better against group IL_08770.1 cutoff score    94.9412; GUC*GCC
Sequence 1965 in group IL_87907.2 with cutoff score    86.0716 does better against group IL_14688.1 cutoff score   100.0000; GUC*GCC
Sequence 1966 in group IL_87907.2 with cutoff score    89.6846 does better against group IL_67095.2 cutoff score    96.4012; GAU*ACC
Sequence 1967 in group IL_87907.2 with cutoff score    94.8534 does better against group IL_67095.2 cutoff score    96.4657; GAC*GCC
Sequence 1968 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_07785.1 cutoff score    92.9769; CUG*CCG
Sequence 1968 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_08770.1 cutoff score    96.4582; CUG*CCG
Sequence 1968 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_14688.1 cutoff score    97.0637; CUG*CCG
Sequence 1969 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1969 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1970 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1970 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1971 in group IL_87907.2 with cutoff score    59.7917 does better against group IL_07785.1 cutoff score    70.1195; GCU*GUC
Sequence 1971 in group IL_87907.2 with cutoff score    59.7917 does better against group IL_08770.1 cutoff score    72.2774; GCU*GUC
Sequence 1971 in group IL_87907.2 with cutoff score    59.7917 does better against group IL_14688.1 cutoff score    82.3936; GCU*GUC
Sequence 1971 in group IL_87907.2 with cutoff score    59.7917 does better against group IL_87907.2 cutoff score    67.0816; GCU*GUC
Sequence 1972 in group IL_87907.2 with cutoff score    84.4824 does better against group IL_67095.2 cutoff score    96.9940; AAU*ACU
Sequence 1973 in group IL_87907.2 with cutoff score    83.4058 does better against group IL_07785.1 cutoff score    90.1097; CUU*ACG
Sequence 1973 in group IL_87907.2 with cutoff score    83.4058 does better against group IL_08770.1 cutoff score    96.9975; CUU*ACG
Sequence 1973 in group IL_87907.2 with cutoff score    83.4058 does better against group IL_14688.1 cutoff score    98.8874; CUU*ACG
Sequence 1974 in group IL_87907.2 with cutoff score    70.1118 does better against group IL_07785.1 cutoff score    76.7139; UCA*UCA
Sequence 1974 in group IL_87907.2 with cutoff score    70.1118 does better against group IL_10796.1 cutoff score    71.0766; UCA*UCA
Sequence 1975 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1975 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1976 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_07785.1 cutoff score    92.9769; CUG*CCG
Sequence 1976 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_08770.1 cutoff score    96.4582; CUG*CCG
Sequence 1976 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_14688.1 cutoff score    97.0637; CUG*CCG
Sequence 1977 in group IL_87907.2 with cutoff score    78.5070 does better against group IL_87907.2 cutoff score    80.0359; GUG*CUU
Sequence 1978 in group IL_87907.2 with cutoff score    94.8534 does better against group IL_67095.2 cutoff score    96.4657; GAC*GCC
Sequence 1979 in group IL_87907.2 with cutoff score    80.4377 does better against group IL_31737.3 cutoff score   100.0000; GAC*GAC
Sequence 1979 in group IL_87907.2 with cutoff score    80.4377 does better against group IL_42997.3 cutoff score    86.2671; GAC*GAC
Sequence 1979 in group IL_87907.2 with cutoff score    80.4377 does better against group IL_57744.1 cutoff score    83.2203; GAC*GAC
Sequence 1980 in group IL_87907.2 with cutoff score    80.7744 does better against group IL_07785.1 cutoff score    91.9874; CCC*GUG
Sequence 1980 in group IL_87907.2 with cutoff score    80.7744 does better against group IL_08770.1 cutoff score    94.3580; CCC*GUG
Sequence 1980 in group IL_87907.2 with cutoff score    80.7744 does better against group IL_14688.1 cutoff score    98.5955; CCC*GUG
Sequence 1980 in group IL_87907.2 with cutoff score    80.7744 does better against group IL_87907.2 cutoff score    87.5560; CCC*GUG
Sequence 1981 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_07785.1 cutoff score    92.9769; CUG*CCG
Sequence 1981 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_08770.1 cutoff score    96.4582; CUG*CCG
Sequence 1981 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_14688.1 cutoff score    97.0637; CUG*CCG
Sequence 1982 in group IL_87907.2 with cutoff score    75.7006 does better against group IL_07785.1 cutoff score    89.0808; AUU*ACU
Sequence 1982 in group IL_87907.2 with cutoff score    75.7006 does better against group IL_08770.1 cutoff score    94.7363; AUU*ACU
Sequence 1982 in group IL_87907.2 with cutoff score    75.7006 does better against group IL_14688.1 cutoff score    99.4942; AUU*ACU
Sequence 1983 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1983 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1984 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_07785.1 cutoff score    92.9769; CUG*CCG
Sequence 1984 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_08770.1 cutoff score    96.4582; CUG*CCG
Sequence 1984 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_14688.1 cutoff score    97.0637; CUG*CCG
Sequence 1985 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_07785.1 cutoff score    92.9769; CUG*CCG
Sequence 1985 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_08770.1 cutoff score    96.4582; CUG*CCG
Sequence 1985 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_14688.1 cutoff score    97.0637; CUG*CCG
Sequence 1986 in group IL_87907.2 with cutoff score    87.8025 does better against group IL_67095.2 cutoff score    98.5976; CAA*UCG
Sequence 1987 in group IL_87907.2 with cutoff score    84.4824 does better against group IL_67095.2 cutoff score    96.9940; AAU*ACU
Sequence 1988 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1988 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1989 in group IL_87907.2 with cutoff score    84.4824 does better against group IL_67095.2 cutoff score    96.9940; AAU*ACU
Sequence 1990 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_07785.1 cutoff score    92.9769; CUG*CCG
Sequence 1990 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_08770.1 cutoff score    96.4582; CUG*CCG
Sequence 1990 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_14688.1 cutoff score    97.0637; CUG*CCG
Sequence 1991 in group IL_87907.2 with cutoff score    66.1061 does better against group IL_10167.6 cutoff score    93.2203; GGC*GGC
Sequence 1991 in group IL_87907.2 with cutoff score    66.1061 does better against group IL_44465.1 cutoff score    95.5204; GGC*GGC
Sequence 1992 in group IL_87907.2 with cutoff score    71.3155 does better against group IL_07785.1 cutoff score    89.6595; AUA*UCU
Sequence 1992 in group IL_87907.2 with cutoff score    71.3155 does better against group IL_08770.1 cutoff score    93.5634; AUA*UCU
Sequence 1992 in group IL_87907.2 with cutoff score    71.3155 does better against group IL_14688.1 cutoff score    99.2335; AUA*UCU
Sequence 1995 in group IL_87907.2 with cutoff score    75.2688 does better against group IL_31737.3 cutoff score    98.8543; GAU*AAC
Sequence 1995 in group IL_87907.2 with cutoff score    75.2688 does better against group IL_42997.3 cutoff score    88.7881; GAU*AAC
Sequence 1995 in group IL_87907.2 with cutoff score    75.2688 does better against group IL_57744.1 cutoff score    81.7084; GAU*AAC
Sequence 1996 in group IL_87907.2 with cutoff score    71.6201 does better against group IL_87907.2 cutoff score    73.1489; GCG*CCU
Sequence 1997 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 1997 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 1998 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_08770.1 cutoff score    48.3113; CAC*GGAG
Sequence 1998 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_31531.3 cutoff score    83.9362; CAC*GGAG
Sequence 1998 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_41344.1 cutoff score    66.1075; CAC*GGAG
Sequence 1998 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_42997.3 cutoff score    49.0665; CAC*GGAG
Sequence 1998 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_55516.2 cutoff score    53.1151; CAC*GGAG
Sequence 1998 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_57744.1 cutoff score    96.5798; CAC*GGAG
Sequence 1998 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_61341.1 cutoff score    68.0937; CAC*GGAG
Sequence 1998 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_83389.2 cutoff score    44.5809; CAC*GGAG
Sequence 1998 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_95570.1 cutoff score    51.9018; CAC*GGAG
Sequence 1999 in group IL_87907.2 with cutoff score    38.6064 does better against group IL_67095.2 cutoff score    54.5813; GCU*GAU
Sequence 1999 in group IL_87907.2 with cutoff score    38.6064 does better against group IL_87907.2 cutoff score    57.3837; GCU*GAU
Sequence 2000 in group IL_87907.2 with cutoff score    78.2714 does better against group IL_07785.1 cutoff score    91.9738; GCC*GUC
Sequence 2000 in group IL_87907.2 with cutoff score    78.2714 does better against group IL_08770.1 cutoff score    94.9412; GCC*GUC
Sequence 2000 in group IL_87907.2 with cutoff score    78.2714 does better against group IL_14688.1 cutoff score   100.0000; GCC*GUC
Sequence 2000 in group IL_87907.2 with cutoff score    78.2714 does better against group IL_87907.2 cutoff score    86.0716; GCC*GUC
Sequence 2001 in group IL_87907.2 with cutoff score    72.3583 does better against group IL_08770.1 cutoff score    74.3374; ACG*CAU
Sequence 2001 in group IL_87907.2 with cutoff score    72.3583 does better against group IL_42997.3 cutoff score    81.8030; ACG*CAU
Sequence 2001 in group IL_87907.2 with cutoff score    72.3583 does better against group IL_67095.2 cutoff score    96.4554; ACG*CAU
Sequence 2001 in group IL_87907.2 with cutoff score    72.3583 does better against group IL_87907.2 cutoff score    92.1876; ACG*CAU
Sequence 2002 in group IL_87907.2 with cutoff score    70.9777 does better against group IL_08770.1 cutoff score    72.8130; UAC*GAA
Sequence 2002 in group IL_87907.2 with cutoff score    70.9777 does better against group IL_14688.1 cutoff score    71.0323; UAC*GAA
Sequence 2002 in group IL_87907.2 with cutoff score    70.9777 does better against group IL_31737.3 cutoff score    98.5366; UAC*GAA
Sequence 2002 in group IL_87907.2 with cutoff score    70.9777 does better against group IL_42997.3 cutoff score    86.6914; UAC*GAA
Sequence 2002 in group IL_87907.2 with cutoff score    70.9777 does better against group IL_57744.1 cutoff score    82.3144; UAC*GAA
Sequence 2003 in group IL_87907.2 with cutoff score    78.2714 does better against group IL_07785.1 cutoff score    91.9738; GCC*GUC
Sequence 2003 in group IL_87907.2 with cutoff score    78.2714 does better against group IL_08770.1 cutoff score    94.9412; GCC*GUC
Sequence 2003 in group IL_87907.2 with cutoff score    78.2714 does better against group IL_14688.1 cutoff score   100.0000; GCC*GUC
Sequence 2003 in group IL_87907.2 with cutoff score    78.2714 does better against group IL_87907.2 cutoff score    86.0716; GCC*GUC
Sequence 2004 in group IL_87907.2 with cutoff score    75.2248 does better against group IL_10167.6 cutoff score    76.8514; CGA*UAG
Sequence 2004 in group IL_87907.2 with cutoff score    75.2248 does better against group IL_44465.1 cutoff score    88.3061; CGA*UAG
Sequence 2004 in group IL_87907.2 with cutoff score    75.2248 does better against group IL_57744.1 cutoff score    83.4214; CGA*UAG
Sequence 2004 in group IL_87907.2 with cutoff score    75.2248 does better against group IL_87907.2 cutoff score    80.5201; CGA*UAG
Sequence 2005 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_55516.2 cutoff score    87.0685; CAC*GGGG
Sequence 2005 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_57744.1 cutoff score    58.3062; CAC*GGGG
Sequence 2005 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_85599.2 cutoff score    86.8417; CAC*GGGG
Sequence 2005 in group IL_87907.2 with cutoff score    36.7603 does better against group IL_96371.1 cutoff score    77.9934; CAC*GGGG
Sequence 2006 in group IL_87907.2 with cutoff score    83.7601 does better against group IL_44465.1 cutoff score    85.5294; GGG*CAC
Sequence 2006 in group IL_87907.2 with cutoff score    83.7601 does better against group IL_57744.1 cutoff score    89.8562; GGG*CAC
Sequence 2006 in group IL_87907.2 with cutoff score    83.7601 does better against group IL_87907.2 cutoff score    90.9986; GGG*CAC
Sequence 2007 in group IL_87907.2 with cutoff score    66.1061 does better against group IL_10167.6 cutoff score    93.2203; GGC*GGC
Sequence 2007 in group IL_87907.2 with cutoff score    66.1061 does better against group IL_44465.1 cutoff score    95.5204; GGC*GGC
Sequence 2008 in group IL_87907.2 with cutoff score    78.5070 does better against group IL_87907.2 cutoff score    80.0359; GUG*CUU
Sequence 2009 in group IL_87907.2 with cutoff score    75.2248 does better against group IL_10167.6 cutoff score    76.8514; CGA*UAG
Sequence 2009 in group IL_87907.2 with cutoff score    75.2248 does better against group IL_44465.1 cutoff score    88.3061; CGA*UAG
Sequence 2009 in group IL_87907.2 with cutoff score    75.2248 does better against group IL_57744.1 cutoff score    83.4214; CGA*UAG
Sequence 2009 in group IL_87907.2 with cutoff score    75.2248 does better against group IL_87907.2 cutoff score    80.5201; CGA*UAG
Sequence 2010 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_07785.1 cutoff score    92.9769; CUG*CCG
Sequence 2010 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_08770.1 cutoff score    96.4582; CUG*CCG
Sequence 2010 in group IL_87907.2 with cutoff score    90.0590 does better against group IL_14688.1 cutoff score    97.0637; CUG*CCG
Sequence 2012 in group IL_87907.2 with cutoff score    80.5201 does better against group IL_44465.1 cutoff score    88.3061; UAG*CGA
Sequence 2012 in group IL_87907.2 with cutoff score    80.5201 does better against group IL_57744.1 cutoff score    83.4214; UAG*CGA
Sequence 2013 in group IL_87907.2 with cutoff score    94.8534 does better against group IL_67095.2 cutoff score    96.4657; GAC*GCC
Sequence 2014 in group IL_87907.2 with cutoff score    83.7601 does better against group IL_44465.1 cutoff score    85.5294; GGG*CAC
Sequence 2014 in group IL_87907.2 with cutoff score    83.7601 does better against group IL_57744.1 cutoff score    89.8562; GGG*CAC
Sequence 2014 in group IL_87907.2 with cutoff score    83.7601 does better against group IL_87907.2 cutoff score    90.9986; GGG*CAC
Sequence 2015 in group IL_87907.2 with cutoff score    83.7601 does better against group IL_44465.1 cutoff score    85.5294; GGG*CAC
Sequence 2015 in group IL_87907.2 with cutoff score    83.7601 does better against group IL_57744.1 cutoff score    89.8562; GGG*CAC
Sequence 2015 in group IL_87907.2 with cutoff score    83.7601 does better against group IL_87907.2 cutoff score    90.9986; GGG*CAC
Sequence 2016 in group IL_87907.2 with cutoff score    83.2934 does better against group IL_44465.1 cutoff score    84.3907; AAC*GGU
Sequence 2016 in group IL_87907.2 with cutoff score    83.2934 does better against group IL_57744.1 cutoff score    85.3242; AAC*GGU
Sequence 2018 in group IL_87907.2 with cutoff score    84.4250 does better against group IL_31737.3 cutoff score    99.5010; CAG*CAG
Sequence 2018 in group IL_87907.2 with cutoff score    84.4250 does better against group IL_42997.3 cutoff score    93.0857; CAG*CAG
Sequence 2020 in group IL_87907.2 with cutoff score    80.5201 does better against group IL_44465.1 cutoff score    88.3061; UAG*CGA
Sequence 2020 in group IL_87907.2 with cutoff score    80.5201 does better against group IL_57744.1 cutoff score    83.4214; UAG*CGA
Sequence 2021 in group IL_87907.2 with cutoff score    75.7006 does better against group IL_07785.1 cutoff score    89.0808; AUU*ACU
Sequence 2021 in group IL_87907.2 with cutoff score    75.7006 does better against group IL_08770.1 cutoff score    94.7363; AUU*ACU
Sequence 2021 in group IL_87907.2 with cutoff score    75.7006 does better against group IL_14688.1 cutoff score    99.4942; AUU*ACU
Sequence 2022 in group IL_87907.2 with cutoff score    71.6201 does better against group IL_87907.2 cutoff score    73.1489; GCG*CCU
Sequence 2024 in group IL_87907.2 with cutoff score    83.3268 does better against group IL_44465.1 cutoff score    86.1281; GAU*AGC
Sequence 2025 in group IL_87907.2 with cutoff score    73.8669 does better against group IL_44465.1 cutoff score    87.5753; UAU*AGA
Sequence 2025 in group IL_87907.2 with cutoff score    73.8669 does better against group IL_57744.1 cutoff score    81.5792; UAU*AGA
Sequence 2026 in group IL_87907.2 with cutoff score    36.9686 does better against group IL_08770.1 cutoff score    42.8902; CAU*AGUG
Sequence 2026 in group IL_87907.2 with cutoff score    36.9686 does better against group IL_57744.1 cutoff score    56.0675; CAU*AGUG
Sequence 2026 in group IL_87907.2 with cutoff score    36.9686 does better against group IL_99358.1 cutoff score    67.3923; CAU*AGUG
Sequence 2027 in group IL_87907.2 with cutoff score    36.9686 does better against group IL_08770.1 cutoff score    42.8902; CAU*AGUG
Sequence 2027 in group IL_87907.2 with cutoff score    36.9686 does better against group IL_57744.1 cutoff score    56.0675; CAU*AGUG
Sequence 2027 in group IL_87907.2 with cutoff score    36.9686 does better against group IL_99358.1 cutoff score    67.3923; CAU*AGUG
Sequence 2028 in group IL_87907.2 with cutoff score    75.2688 does better against group IL_31737.3 cutoff score    98.8543; GAU*AAC
Sequence 2028 in group IL_87907.2 with cutoff score    75.2688 does better against group IL_42997.3 cutoff score    88.7881; GAU*AAC
Sequence 2028 in group IL_87907.2 with cutoff score    75.2688 does better against group IL_57744.1 cutoff score    81.7084; GAU*AAC
Sequence 2030 in group IL_87907.2 with cutoff score    61.6294 does better against group IL_10167.6 cutoff score    67.1398; CAG*UGG
Sequence 2030 in group IL_87907.2 with cutoff score    61.6294 does better against group IL_14688.1 cutoff score    64.7706; CAG*UGG
Sequence 2030 in group IL_87907.2 with cutoff score    61.6294 does better against group IL_44465.1 cutoff score    82.7434; CAG*UGG
Sequence 2030 in group IL_87907.2 with cutoff score    61.6294 does better against group IL_57744.1 cutoff score    62.8825; CAG*UGG
Sequence 2030 in group IL_87907.2 with cutoff score    61.6294 does better against group IL_85599.2 cutoff score    71.6732; CAG*UGG
Sequence 2031 in group IL_87907.2 with cutoff score    80.5201 does better against group IL_44465.1 cutoff score    88.3061; UAG*CGA
Sequence 2031 in group IL_87907.2 with cutoff score    80.5201 does better against group IL_57744.1 cutoff score    83.4214; UAG*CGA
Sequence 2032 in group IL_87907.2 with cutoff score    70.9777 does better against group IL_08770.1 cutoff score    72.8130; UAC*GAA
Sequence 2032 in group IL_87907.2 with cutoff score    70.9777 does better against group IL_14688.1 cutoff score    71.0323; UAC*GAA
Sequence 2032 in group IL_87907.2 with cutoff score    70.9777 does better against group IL_31737.3 cutoff score    98.5366; UAC*GAA
Sequence 2032 in group IL_87907.2 with cutoff score    70.9777 does better against group IL_42997.3 cutoff score    86.6914; UAC*GAA
Sequence 2032 in group IL_87907.2 with cutoff score    70.9777 does better against group IL_57744.1 cutoff score    82.3144; UAC*GAA
Sequence 2034 in group IL_87907.2 with cutoff score    84.4250 does better against group IL_31737.3 cutoff score    99.5010; CAG*CAG
Sequence 2034 in group IL_87907.2 with cutoff score    84.4250 does better against group IL_42997.3 cutoff score    93.0857; CAG*CAG
Sequence 2035 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_07785.1 cutoff score    99.9865; GUC*GUC
Sequence 2035 in group IL_87907.2 with cutoff score    96.0126 does better against group IL_28037.2 cutoff score   100.0000; GUC*GUC
Sequence 2036 in group IL_87907.2 with cutoff score    83.2934 does better against group IL_44465.1 cutoff score    84.3907; AAC*GGU
Sequence 2036 in group IL_87907.2 with cutoff score    83.2934 does better against group IL_57744.1 cutoff score    85.3242; AAC*GGU
Sequence 2037 in group IL_87907.2 with cutoff score    73.8669 does better against group IL_44465.1 cutoff score    87.5753; UAU*AGA
Sequence 2037 in group IL_87907.2 with cutoff score    73.8669 does better against group IL_57744.1 cutoff score    81.5792; UAU*AGA
Sequence 2038 in group IL_87907.2 with cutoff score    82.2757 does better against group IL_44465.1 cutoff score    85.4623; GGC*GAC
Sequence 2038 in group IL_87907.2 with cutoff score    82.2757 does better against group IL_57744.1 cutoff score    86.8361; GGC*GAC
Sequence 2038 in group IL_87907.2 with cutoff score    82.2757 does better against group IL_87907.2 cutoff score    88.4957; GGC*GAC
Sequence 2039 in group IL_87907.2 with cutoff score    55.4095 does better against group IL_10167.6 cutoff score    69.9089; CGG*UAG
Sequence 2039 in group IL_87907.2 with cutoff score    55.4095 does better against group IL_44465.1 cutoff score    69.1536; CGG*UAG
Sequence 2039 in group IL_87907.2 with cutoff score    55.4095 does better against group IL_57744.1 cutoff score    73.2196; CGG*UAG
Sequence 2039 in group IL_87907.2 with cutoff score    55.4095 does better against group IL_85599.2 cutoff score    78.8068; CGG*UAG
Sequence 2039 in group IL_87907.2 with cutoff score    55.4095 does better against group IL_87907.2 cutoff score    65.6150; CGG*UAG
Sequence 2041 in group IL_87907.2 with cutoff score    59.0551 does better against group IL_10167.6 cutoff score    95.1559; CGA*UGG
Sequence 2041 in group IL_87907.2 with cutoff score    59.0551 does better against group IL_44465.1 cutoff score    98.6199; CGA*UGG
Sequence 2042 in group IL_87907.2 with cutoff score    85.4079 does better against group IL_87907.2 cutoff score    86.4599; ACG*CCU
Sequence 2043 in group IL_87907.2 with cutoff score    86.2631 does better against group IL_44465.1 cutoff score    86.9260; CGG*CAG
Sequence 2043 in group IL_87907.2 with cutoff score    86.2631 does better against group IL_57744.1 cutoff score    87.3474; CGG*CAG
Sequence 2043 in group IL_87907.2 with cutoff score    86.2631 does better against group IL_87907.2 cutoff score    92.4830; CGG*CAG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_08770.1 cutoff score    48.3113; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_10389.1 cutoff score    32.7947; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_14688.1 cutoff score    45.1420; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_31531.3 cutoff score    33.7280; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_41344.1 cutoff score    56.8567; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_55516.2 cutoff score    61.2145; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_57744.1 cutoff score    86.2693; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_67095.2 cutoff score    52.6467; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_82107.4 cutoff score    51.3286; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_83389.2 cutoff score    44.5809; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_85599.2 cutoff score    48.0562; CAC*GAGG
Sequence 2044 in group IL_87907.2 with cutoff score    29.6680 does better against group IL_90351.1 cutoff score    76.3402; CAC*GAGG
Sequence 2045 in group IL_87907.2 with cutoff score    58.9618 does better against group IL_10167.6 cutoff score    61.9071; UAU*AGG
Sequence 2045 in group IL_87907.2 with cutoff score    58.9618 does better against group IL_44465.1 cutoff score    68.4228; UAU*AGG
Sequence 2045 in group IL_87907.2 with cutoff score    58.9618 does better against group IL_57744.1 cutoff score    71.3774; UAU*AGG
Sequence 2045 in group IL_87907.2 with cutoff score    58.9618 does better against group IL_85599.2 cutoff score    76.4108; UAU*AGG
Sequence 2046 in group IL_87907.2 with cutoff score    57.5570 does better against group IL_14688.1 cutoff score    62.2262; UAG*CAG
Sequence 2046 in group IL_87907.2 with cutoff score    57.5570 does better against group IL_31737.3 cutoff score    85.8607; UAG*CAG
Sequence 2046 in group IL_87907.2 with cutoff score    57.5570 does better against group IL_42997.3 cutoff score    68.7028; UAG*CAG
Sequence 2046 in group IL_87907.2 with cutoff score    57.5570 does better against group IL_57744.1 cutoff score    69.6037; UAG*CAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_08770.1 cutoff score    45.6278; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_14688.1 cutoff score    59.7289; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_25463.1 cutoff score    22.4438; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_31531.3 cutoff score    28.4912; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_31737.3 cutoff score    45.0016; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_41344.1 cutoff score    65.3549; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_44325.1 cutoff score    35.7668; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_55516.2 cutoff score    38.2074; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_57744.1 cutoff score    37.5639; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_61341.1 cutoff score    35.0588; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_82107.4 cutoff score    25.0935; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_83389.2 cutoff score    99.4791; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_90351.1 cutoff score    48.3472; CUAC*GAG
Sequence 2047 in group IL_87907.2 with cutoff score    21.6100 does better against group IL_99358.1 cutoff score    58.0932; CUAC*GAG
Sequence 2075 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2076 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2077 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_33761.2 cutoff score    93.5619; AUC*GU
Sequence 2077 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_73452.2 cutoff score    96.6203; AUC*GU
Sequence 2077 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_81831.1 cutoff score    98.6360; AUC*GU
Sequence 2078 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_73452.2 cutoff score    97.1367; GUU*AC
Sequence 2078 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_81831.1 cutoff score    99.2222; GUU*AC
Sequence 2079 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_73452.2 cutoff score    97.1367; GUU*AC
Sequence 2079 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_81831.1 cutoff score    99.2222; GUU*AC
Sequence 2081 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_73452.2 cutoff score    97.1367; GUU*AC
Sequence 2081 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_81831.1 cutoff score    99.2222; GUU*AC
Sequence 2083 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_73452.2 cutoff score    97.1819; GUA*UC
Sequence 2083 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_81831.1 cutoff score   100.0000; GUA*UC
Sequence 2084 in group IL_89505.4 with cutoff score    87.9541 does better against group IL_73452.2 cutoff score    97.1367; UUG*CA
Sequence 2084 in group IL_89505.4 with cutoff score    87.9541 does better against group IL_81831.1 cutoff score    99.9989; UUG*CA
Sequence 2084 in group IL_89505.4 with cutoff score    87.9541 does better against group IL_90729.1 cutoff score    89.8630; UUG*CA
Sequence 2085 in group IL_89505.4 with cutoff score    81.2436 does better against group IL_33761.2 cutoff score    81.9173; UUA*UA
Sequence 2085 in group IL_89505.4 with cutoff score    81.2436 does better against group IL_48076.6 cutoff score    85.9687; UUA*UA
Sequence 2085 in group IL_89505.4 with cutoff score    81.2436 does better against group IL_73452.2 cutoff score    95.8481; UUA*UA
Sequence 2085 in group IL_89505.4 with cutoff score    81.2436 does better against group IL_81831.1 cutoff score    99.9945; UUA*UA
Sequence 2085 in group IL_89505.4 with cutoff score    81.2436 does better against group IL_90729.1 cutoff score    86.2434; UUA*UA
Sequence 2087 in group IL_89505.4 with cutoff score    81.2436 does better against group IL_33761.2 cutoff score    81.9173; UUA*UA
Sequence 2087 in group IL_89505.4 with cutoff score    81.2436 does better against group IL_48076.6 cutoff score    85.9687; UUA*UA
Sequence 2087 in group IL_89505.4 with cutoff score    81.2436 does better against group IL_73452.2 cutoff score    95.8481; UUA*UA
Sequence 2087 in group IL_89505.4 with cutoff score    81.2436 does better against group IL_81831.1 cutoff score    99.9945; UUA*UA
Sequence 2087 in group IL_89505.4 with cutoff score    81.2436 does better against group IL_90729.1 cutoff score    86.2434; UUA*UA
Sequence 2089 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2090 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 2090 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 2090 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 2092 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_33761.2 cutoff score    94.6779; UUC*GA
Sequence 2092 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_48076.6 cutoff score    89.1563; UUC*GA
Sequence 2092 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_73452.2 cutoff score    96.5751; UUC*GA
Sequence 2092 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_81831.1 cutoff score    99.2812; UUC*GA
Sequence 2094 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2095 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_73452.2 cutoff score    97.1819; AUG*CU
Sequence 2095 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_81831.1 cutoff score    99.3537; AUG*CU
Sequence 2095 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_90729.1 cutoff score    92.2383; AUG*CU
Sequence 2099 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_33761.2 cutoff score    93.5619; AUC*GU
Sequence 2099 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_73452.2 cutoff score    96.6203; AUC*GU
Sequence 2099 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_81831.1 cutoff score    98.6360; AUC*GU
Sequence 2100 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_33761.2 cutoff score    93.5619; AUC*GU
Sequence 2100 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_73452.2 cutoff score    96.6203; AUC*GU
Sequence 2100 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_81831.1 cutoff score    98.6360; AUC*GU
Sequence 2102 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2104 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_73452.2 cutoff score    97.1819; AUG*CU
Sequence 2104 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_81831.1 cutoff score    99.3537; AUG*CU
Sequence 2104 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_90729.1 cutoff score    92.2383; AUG*CU
Sequence 2105 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_73452.2 cutoff score    97.1367; GUU*AC
Sequence 2105 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_81831.1 cutoff score    99.2222; GUU*AC
Sequence 2106 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_07039.3 cutoff score    86.9676; UUC*GG
Sequence 2106 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_33761.2 cutoff score    92.8880; UUC*GG
Sequence 2106 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_48076.6 cutoff score    91.0117; UUC*GG
Sequence 2107 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_33761.2 cutoff score    93.5619; AUC*GU
Sequence 2107 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_73452.2 cutoff score    96.6203; AUC*GU
Sequence 2107 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_81831.1 cutoff score    98.6360; AUC*GU
Sequence 2109 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_73452.2 cutoff score    95.8933; AUA*UU
Sequence 2109 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_81831.1 cutoff score    99.3493; AUA*UU
Sequence 2109 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_90729.1 cutoff score    88.6188; AUA*UU
Sequence 2110 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_73452.2 cutoff score    97.1367; GUU*AC
Sequence 2110 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_81831.1 cutoff score    99.2222; GUU*AC
Sequence 2112 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_73452.2 cutoff score    97.1819; GUA*UC
Sequence 2112 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_81831.1 cutoff score   100.0000; GUA*UC
Sequence 2114 in group IL_89505.4 with cutoff score    79.2735 does better against group IL_81831.1 cutoff score    82.4165; GUG*UC
Sequence 2115 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_73452.2 cutoff score    97.1819; GUA*UC
Sequence 2115 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_81831.1 cutoff score   100.0000; GUA*UC
Sequence 2116 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2117 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_73452.2 cutoff score    97.1819; GUA*UC
Sequence 2117 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_81831.1 cutoff score   100.0000; GUA*UC
Sequence 2118 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 2118 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 2118 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 2120 in group IL_89505.4 with cutoff score    79.2735 does better against group IL_81831.1 cutoff score    82.4165; GUG*UC
Sequence 2121 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_73452.2 cutoff score    97.1819; GUA*UC
Sequence 2121 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_81831.1 cutoff score   100.0000; GUA*UC
Sequence 2123 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_73452.2 cutoff score    97.1819; GUA*UC
Sequence 2123 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_81831.1 cutoff score   100.0000; GUA*UC
Sequence 2124 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_73452.2 cutoff score    95.8933; AUA*UU
Sequence 2124 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_81831.1 cutoff score    99.3493; AUA*UU
Sequence 2124 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_90729.1 cutoff score    88.6188; AUA*UU
Sequence 2125 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_73452.2 cutoff score    95.8933; AUA*UU
Sequence 2125 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_81831.1 cutoff score    99.3493; AUA*UU
Sequence 2125 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_90729.1 cutoff score    88.6188; AUA*UU
Sequence 2126 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_73452.2 cutoff score    97.1819; GUA*UC
Sequence 2126 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_81831.1 cutoff score   100.0000; GUA*UC
Sequence 2127 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_33761.2 cutoff score    93.5619; AUC*GU
Sequence 2127 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_73452.2 cutoff score    96.6203; AUC*GU
Sequence 2127 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_81831.1 cutoff score    98.6360; AUC*GU
Sequence 2128 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_33761.2 cutoff score    94.6229; CUC*GG
Sequence 2128 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_48076.6 cutoff score    94.7421; CUC*GG
Sequence 2128 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_51454.3 cutoff score    90.1703; CUC*GG
Sequence 2128 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_73452.2 cutoff score    97.3474; CUC*GG
Sequence 2128 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_81831.1 cutoff score    98.6984; CUC*GG
Sequence 2128 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_90729.1 cutoff score    87.7596; CUC*GG
Sequence 2129 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_07039.3 cutoff score    86.9676; UUC*GG
Sequence 2129 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_33761.2 cutoff score    92.8880; UUC*GG
Sequence 2129 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_48076.6 cutoff score    91.0117; UUC*GG
Sequence 2130 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_33761.2 cutoff score    93.5619; AUC*GU
Sequence 2130 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_73452.2 cutoff score    96.6203; AUC*GU
Sequence 2130 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_81831.1 cutoff score    98.6360; AUC*GU
Sequence 2132 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_33761.2 cutoff score    93.5619; AUC*GU
Sequence 2132 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_73452.2 cutoff score    96.6203; AUC*GU
Sequence 2132 in group IL_89505.4 with cutoff score    90.3584 does better against group IL_81831.1 cutoff score    98.6360; AUC*GU
Sequence 2134 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2135 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2136 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_73452.2 cutoff score    97.1367; GUU*AC
Sequence 2136 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_81831.1 cutoff score    99.2222; GUU*AC
Sequence 2137 in group IL_89505.4 with cutoff score    62.8211 does better against group IL_07039.3 cutoff score    83.5846; UUG*UG
Sequence 2137 in group IL_89505.4 with cutoff score    62.8211 does better against group IL_81831.1 cutoff score    64.4509; UUG*UG
Sequence 2138 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_73452.2 cutoff score    97.1819; AUG*CU
Sequence 2138 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_81831.1 cutoff score    99.3537; AUG*CU
Sequence 2138 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_90729.1 cutoff score    92.2383; AUG*CU
Sequence 2139 in group IL_89505.4 with cutoff score    67.2276 does better against group IL_07039.3 cutoff score    69.2582; UUG*UA
Sequence 2139 in group IL_89505.4 with cutoff score    67.2276 does better against group IL_73452.2 cutoff score    74.2107; UUG*UA
Sequence 2139 in group IL_89505.4 with cutoff score    67.2276 does better against group IL_81831.1 cutoff score    82.4111; UUG*UA
Sequence 2140 in group IL_89505.4 with cutoff score    67.2276 does better against group IL_07039.3 cutoff score    69.2582; UUG*UA
Sequence 2140 in group IL_89505.4 with cutoff score    67.2276 does better against group IL_73452.2 cutoff score    74.2107; UUG*UA
Sequence 2140 in group IL_89505.4 with cutoff score    67.2276 does better against group IL_81831.1 cutoff score    82.4111; UUG*UA
Sequence 2141 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_07039.3 cutoff score    86.9676; UUC*GG
Sequence 2141 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_33761.2 cutoff score    92.8880; UUC*GG
Sequence 2141 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_48076.6 cutoff score    91.0117; UUC*GG
Sequence 2143 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_73452.2 cutoff score    97.1367; GUU*AC
Sequence 2143 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_81831.1 cutoff score    99.2222; GUU*AC
Sequence 2144 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_73452.2 cutoff score    97.1367; GUU*AC
Sequence 2144 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_81831.1 cutoff score    99.2222; GUU*AC
Sequence 2145 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_73452.2 cutoff score    97.1367; GUU*AC
Sequence 2145 in group IL_89505.4 with cutoff score    92.5913 does better against group IL_81831.1 cutoff score    99.2222; GUU*AC
Sequence 2147 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 2147 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 2147 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 2148 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 2148 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 2148 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 2149 in group IL_89505.4 with cutoff score    76.1389 does better against group IL_07039.3 cutoff score    89.0922; UUU*AG
Sequence 2149 in group IL_89505.4 with cutoff score    76.1389 does better against group IL_33761.2 cutoff score    80.2629; UUU*AG
Sequence 2149 in group IL_89505.4 with cutoff score    76.1389 does better against group IL_48076.6 cutoff score    79.1436; UUU*AG
Sequence 2149 in group IL_89505.4 with cutoff score    76.1389 does better against group IL_81831.1 cutoff score    81.2565; UUU*AG
Sequence 2150 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_33761.2 cutoff score    94.6779; UUC*GA
Sequence 2150 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_48076.6 cutoff score    89.1563; UUC*GA
Sequence 2150 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_73452.2 cutoff score    96.5751; UUC*GA
Sequence 2150 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_81831.1 cutoff score    99.2812; UUC*GA
Sequence 2151 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_73452.2 cutoff score    95.8933; AUA*UU
Sequence 2151 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_81831.1 cutoff score    99.3493; AUA*UU
Sequence 2151 in group IL_89505.4 with cutoff score    85.0190 does better against group IL_90729.1 cutoff score    88.6188; AUA*UU
Sequence 2152 in group IL_89505.4 with cutoff score    83.5476 does better against group IL_07039.3 cutoff score    89.8813; UUG*CG
Sequence 2153 in group IL_89505.4 with cutoff score    83.5476 does better against group IL_07039.3 cutoff score    89.8813; UUG*CG
Sequence 2154 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 2154 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 2154 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 2156 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2157 in group IL_89505.4 with cutoff score    84.3208 does better against group IL_73452.2 cutoff score    95.8481; AUU*AU
Sequence 2157 in group IL_89505.4 with cutoff score    84.3208 does better against group IL_81831.1 cutoff score    98.5715; AUU*AU
Sequence 2157 in group IL_89505.4 with cutoff score    84.3208 does better against group IL_90729.1 cutoff score    86.8539; AUU*AU
Sequence 2158 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2159 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2160 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2161 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2162 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2163 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2164 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2165 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2166 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_73452.2 cutoff score    97.1819; AUG*CU
Sequence 2166 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_81831.1 cutoff score    99.3537; AUG*CU
Sequence 2166 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_90729.1 cutoff score    92.2383; AUG*CU
Sequence 2168 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2169 in group IL_89505.4 with cutoff score    84.3208 does better against group IL_73452.2 cutoff score    95.8481; AUU*AU
Sequence 2169 in group IL_89505.4 with cutoff score    84.3208 does better against group IL_81831.1 cutoff score    98.5715; AUU*AU
Sequence 2169 in group IL_89505.4 with cutoff score    84.3208 does better against group IL_90729.1 cutoff score    86.8539; AUU*AU
Sequence 2170 in group IL_89505.4 with cutoff score    84.3208 does better against group IL_73452.2 cutoff score    95.8481; AUU*AU
Sequence 2170 in group IL_89505.4 with cutoff score    84.3208 does better against group IL_81831.1 cutoff score    98.5715; AUU*AU
Sequence 2170 in group IL_89505.4 with cutoff score    84.3208 does better against group IL_90729.1 cutoff score    86.8539; AUU*AU
Sequence 2171 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_73452.2 cutoff score    97.1819; GUA*UC
Sequence 2171 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_81831.1 cutoff score   100.0000; GUA*UC
Sequence 2172 in group IL_89505.4 with cutoff score    98.6290 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2173 in group IL_89505.4 with cutoff score    83.5476 does better against group IL_07039.3 cutoff score    89.8813; UUG*CG
Sequence 2174 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 2174 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 2174 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 2177 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_07039.3 cutoff score    86.9676; UUC*GG
Sequence 2177 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_33761.2 cutoff score    92.8880; UUC*GG
Sequence 2177 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_48076.6 cutoff score    91.0117; UUC*GG
Sequence 2178 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_73452.2 cutoff score    97.1819; GUA*UC
Sequence 2178 in group IL_89505.4 with cutoff score    93.2895 does better against group IL_81831.1 cutoff score   100.0000; GUA*UC
Sequence 2179 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_07039.3 cutoff score    86.9676; UUC*GG
Sequence 2179 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_33761.2 cutoff score    92.8880; UUC*GG
Sequence 2179 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_48076.6 cutoff score    91.0117; UUC*GG
Sequence 2180 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_07039.3 cutoff score    86.9676; UUC*GG
Sequence 2180 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_33761.2 cutoff score    92.8880; UUC*GG
Sequence 2180 in group IL_89505.4 with cutoff score    82.1765 does better against group IL_48076.6 cutoff score    91.0117; UUC*GG
Sequence 2182 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 2182 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 2182 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 2185 in group IL_89505.4 with cutoff score    83.5476 does better against group IL_07039.3 cutoff score    89.8813; UUG*CG
Sequence 2186 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_73452.2 cutoff score    97.1819; AUG*CU
Sequence 2186 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_81831.1 cutoff score    99.3537; AUG*CU
Sequence 2186 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_90729.1 cutoff score    92.2383; AUG*CU
Sequence 2187 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_73452.2 cutoff score    97.1819; AUG*CU
Sequence 2187 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_81831.1 cutoff score    99.3537; AUG*CU
Sequence 2187 in group IL_89505.4 with cutoff score    91.7295 does better against group IL_90729.1 cutoff score    92.2383; AUG*CU
Sequence 2188 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 2188 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 2188 in group IL_89505.4 with cutoff score    88.9804 does better against group IL_90729.1 cutoff score    93.5150; CUG*CG
Sequence 2189 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_33761.2 cutoff score    94.6779; UUC*GA
Sequence 2189 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_48076.6 cutoff score    89.1563; UUC*GA
Sequence 2189 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_73452.2 cutoff score    96.5751; UUC*GA
Sequence 2189 in group IL_89505.4 with cutoff score    86.5830 does better against group IL_81831.1 cutoff score    99.2812; UUC*GA
Sequence 2190 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_33761.2 cutoff score    94.6229; CUC*GG
Sequence 2190 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_48076.6 cutoff score    94.7421; CUC*GG
Sequence 2190 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_51454.3 cutoff score    90.1703; CUC*GG
Sequence 2190 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_73452.2 cutoff score    97.3474; CUC*GG
Sequence 2190 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_81831.1 cutoff score    98.6984; CUC*GG
Sequence 2190 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_90729.1 cutoff score    87.7596; CUC*GG
Sequence 2191 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_33761.2 cutoff score    94.6229; CUC*GG
Sequence 2191 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_48076.6 cutoff score    94.7421; CUC*GG
Sequence 2191 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_51454.3 cutoff score    90.1703; CUC*GG
Sequence 2191 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_73452.2 cutoff score    97.3474; CUC*GG
Sequence 2191 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_81831.1 cutoff score    98.6984; CUC*GG
Sequence 2191 in group IL_89505.4 with cutoff score    87.6093 does better against group IL_90729.1 cutoff score    87.7596; CUC*GG
Sequence 2195 in group IL_90351.1 with cutoff score    99.2616 does better against group IL_31531.3 cutoff score   100.0000; GAAG*CAC
Sequence 2195 in group IL_90351.1 with cutoff score    99.2616 does better against group IL_41344.1 cutoff score   100.0000; GAAG*CAC
Sequence 2196 in group IL_90351.1 with cutoff score    99.2616 does better against group IL_31531.3 cutoff score   100.0000; GAAG*CAC
Sequence 2196 in group IL_90351.1 with cutoff score    99.2616 does better against group IL_41344.1 cutoff score   100.0000; GAAG*CAC
Sequence 2198 in group IL_90351.1 with cutoff score    65.2938 does better against group IL_06549.2 cutoff score    95.8141; GAAUG*CGC
Sequence 2198 in group IL_90351.1 with cutoff score    65.2938 does better against group IL_36516.3 cutoff score   100.0000; GAAUG*CGC
Sequence 2198 in group IL_90351.1 with cutoff score    65.2938 does better against group IL_57881.1 cutoff score    69.4790; GAAUG*CGC
Sequence 2200 in group IL_90351.1 with cutoff score    82.5963 does better against group IL_15698.3 cutoff score    96.8921; UAAC*GUA
Sequence 2206 in group IL_90729.1 with cutoff score    94.6156 does better against group IL_26793.1 cutoff score    97.9954; GAU*AC
Sequence 2206 in group IL_90729.1 with cutoff score    94.6156 does better against group IL_42771.1 cutoff score    96.2217; GAU*AC
Sequence 2207 in group IL_90729.1 with cutoff score    96.0385 does better against group IL_10569.1 cutoff score    99.9941; AAG*CU
Sequence 2207 in group IL_90729.1 with cutoff score    96.0385 does better against group IL_26793.1 cutoff score    99.9547; AAG*CU
Sequence 2207 in group IL_90729.1 with cutoff score    96.0385 does better against group IL_42771.1 cutoff score    97.3953; AAG*CU
Sequence 2211 in group IL_90729.1 with cutoff score    96.1999 does better against group IL_73452.2 cutoff score    98.4705; GUG*CC
Sequence 2211 in group IL_90729.1 with cutoff score    96.1999 does better against group IL_81831.1 cutoff score   100.0000; GUG*CC
Sequence 2211 in group IL_90729.1 with cutoff score    96.1999 does better against group IL_89505.4 cutoff score   100.0000; GUG*CC
Sequence 2212 in group IL_90729.1 with cutoff score    89.8955 does better against group IL_48076.6 cutoff score    91.5545; CUA*UG
Sequence 2212 in group IL_90729.1 with cutoff score    89.8955 does better against group IL_73452.2 cutoff score    96.6203; CUA*UG
Sequence 2212 in group IL_90729.1 with cutoff score    89.8955 does better against group IL_81831.1 cutoff score    99.4118; CUA*UG
Sequence 2213 in group IL_90729.1 with cutoff score    96.1999 does better against group IL_73452.2 cutoff score    98.4705; GUG*CC
Sequence 2213 in group IL_90729.1 with cutoff score    96.1999 does better against group IL_81831.1 cutoff score   100.0000; GUG*CC
Sequence 2213 in group IL_90729.1 with cutoff score    96.1999 does better against group IL_89505.4 cutoff score   100.0000; GUG*CC
Sequence 2216 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_10569.1 cutoff score    97.0299; CAA*UG
Sequence 2216 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_26793.1 cutoff score    96.6030; CAA*UG
Sequence 2216 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_42771.1 cutoff score   100.0000; CAA*UG
Sequence 2216 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_48076.6 cutoff score    95.9947; CAA*UG
Sequence 2216 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_51454.3 cutoff score    95.0778; CAA*UG
Sequence 2218 in group IL_90729.1 with cutoff score    92.2383 does better against group IL_73452.2 cutoff score    97.1819; AUG*CU
Sequence 2218 in group IL_90729.1 with cutoff score    92.2383 does better against group IL_81831.1 cutoff score    99.3537; AUG*CU
Sequence 2219 in group IL_90729.1 with cutoff score    70.7902 does better against group IL_26793.1 cutoff score    91.1435; ACU*AU
Sequence 2219 in group IL_90729.1 with cutoff score    70.7902 does better against group IL_51454.3 cutoff score    74.6547; ACU*AU
Sequence 2219 in group IL_90729.1 with cutoff score    70.7902 does better against group IL_61258.15 cutoff score    91.3710; ACU*AU
Sequence 2220 in group IL_90729.1 with cutoff score    77.4513 does better against group IL_26793.1 cutoff score    93.6229; CCG*CG
Sequence 2220 in group IL_90729.1 with cutoff score    77.4513 does better against group IL_61258.15 cutoff score    94.7736; CCG*CG
Sequence 2220 in group IL_90729.1 with cutoff score    77.4513 does better against group IL_63775.1 cutoff score   100.0000; CCG*CG
Sequence 2221 in group IL_90729.1 with cutoff score    93.5150 does better against group IL_73452.2 cutoff score    97.9089; CUG*CG
Sequence 2221 in group IL_90729.1 with cutoff score    93.5150 does better against group IL_81831.1 cutoff score    99.4161; CUG*CG
Sequence 2222 in group IL_90729.1 with cutoff score    92.2383 does better against group IL_73452.2 cutoff score    97.1819; AUG*CU
Sequence 2222 in group IL_90729.1 with cutoff score    92.2383 does better against group IL_81831.1 cutoff score    99.3537; AUG*CU
Sequence 2223 in group IL_90729.1 with cutoff score    90.4444 does better against group IL_33761.2 cutoff score    94.5085; GUC*GC
Sequence 2223 in group IL_90729.1 with cutoff score    90.4444 does better against group IL_48076.6 cutoff score    90.4927; GUC*GC
Sequence 2223 in group IL_90729.1 with cutoff score    90.4444 does better against group IL_73452.2 cutoff score    97.9089; GUC*GC
Sequence 2223 in group IL_90729.1 with cutoff score    90.4444 does better against group IL_81831.1 cutoff score    99.2866; GUC*GC
Sequence 2223 in group IL_90729.1 with cutoff score    90.4444 does better against group IL_89505.4 cutoff score    98.6290; GUC*GC
Sequence 2225 in group IL_90729.1 with cutoff score    74.7590 does better against group IL_00225.13 cutoff score    90.7602; GGG*CC
Sequence 2225 in group IL_90729.1 with cutoff score    74.7590 does better against group IL_07039.3 cutoff score    78.7092; GGG*CC
Sequence 2225 in group IL_90729.1 with cutoff score    74.7590 does better against group IL_16386.4 cutoff score    97.8881; GGG*CC
Sequence 2225 in group IL_90729.1 with cutoff score    74.7590 does better against group IL_48076.6 cutoff score    82.3931; GGG*CC
Sequence 2225 in group IL_90729.1 with cutoff score    74.7590 does better against group IL_66635.5 cutoff score   100.0000; GGG*CC
Sequence 2226 in group IL_90729.1 with cutoff score    52.5819 does better against group IL_42626.2 cutoff score    82.4497; GUCC*GC
Sequence 2226 in group IL_90729.1 with cutoff score    52.5819 does better against group IL_66635.5 cutoff score    77.8453; GUCC*GC
Sequence 2226 in group IL_90729.1 with cutoff score    52.5819 does better against group IL_79895.1 cutoff score   100.0000; GUCC*GC
Sequence 2226 in group IL_90729.1 with cutoff score    52.5819 does better against group IL_82107.4 cutoff score    69.8135; GUCC*GC
Sequence 2227 in group IL_90729.1 with cutoff score    89.8955 does better against group IL_48076.6 cutoff score    91.5545; CUA*UG
Sequence 2227 in group IL_90729.1 with cutoff score    89.8955 does better against group IL_73452.2 cutoff score    96.6203; CUA*UG
Sequence 2227 in group IL_90729.1 with cutoff score    89.8955 does better against group IL_81831.1 cutoff score    99.4118; CUA*UG
Sequence 2228 in group IL_90729.1 with cutoff score    89.8955 does better against group IL_48076.6 cutoff score    91.5545; CUA*UG
Sequence 2228 in group IL_90729.1 with cutoff score    89.8955 does better against group IL_73452.2 cutoff score    96.6203; CUA*UG
Sequence 2228 in group IL_90729.1 with cutoff score    89.8955 does better against group IL_81831.1 cutoff score    99.4118; CUA*UG
Sequence 2229 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_10569.1 cutoff score    97.0299; CAA*UG
Sequence 2229 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_26793.1 cutoff score    96.6030; CAA*UG
Sequence 2229 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_42771.1 cutoff score   100.0000; CAA*UG
Sequence 2229 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_48076.6 cutoff score    95.9947; CAA*UG
Sequence 2229 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_51454.3 cutoff score    95.0778; CAA*UG
Sequence 2230 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_10569.1 cutoff score    97.0299; CAA*UG
Sequence 2230 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_26793.1 cutoff score    96.6030; CAA*UG
Sequence 2230 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_42771.1 cutoff score   100.0000; CAA*UG
Sequence 2230 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_48076.6 cutoff score    95.9947; CAA*UG
Sequence 2230 in group IL_90729.1 with cutoff score    93.6956 does better against group IL_51454.3 cutoff score    95.0778; CAA*UG
Sequence 2231 in group IL_90729.1 with cutoff score    70.6331 does better against group IL_07039.3 cutoff score    87.8250; UUA*UG
Sequence 2231 in group IL_90729.1 with cutoff score    70.6331 does better against group IL_33761.2 cutoff score    80.1273; UUA*UG
Sequence 2231 in group IL_90729.1 with cutoff score    70.6331 does better against group IL_48076.6 cutoff score    87.8241; UUA*UG
Sequence 2231 in group IL_90729.1 with cutoff score    70.6331 does better against group IL_73452.2 cutoff score    73.7943; UUA*UG
Sequence 2231 in group IL_90729.1 with cutoff score    70.6331 does better against group IL_81831.1 cutoff score    82.0343; UUA*UG
Sequence 2231 in group IL_90729.1 with cutoff score    70.6331 does better against group IL_89505.4 cutoff score    76.8371; UUA*UG
Sequence 2232 in group IL_90729.1 with cutoff score    52.7915 does better against group IL_42626.2 cutoff score    54.1970; AAUU*AU
Sequence 2232 in group IL_90729.1 with cutoff score    52.7915 does better against group IL_50694.7 cutoff score    75.0946; AAUU*AU
Sequence 2232 in group IL_90729.1 with cutoff score    52.7915 does better against group IL_59877.1 cutoff score    63.8029; AAUU*AU
Sequence 2232 in group IL_90729.1 with cutoff score    52.7915 does better against group IL_66635.5 cutoff score    82.1169; AAUU*AU
Sequence 2232 in group IL_90729.1 with cutoff score    52.7915 does better against group IL_73452.2 cutoff score    60.9831; AAUU*AU
Sequence 2232 in group IL_90729.1 with cutoff score    52.7915 does better against group IL_76709.2 cutoff score    98.2550; AAUU*AU
Sequence 2232 in group IL_90729.1 with cutoff score    52.7915 does better against group IL_79895.1 cutoff score    98.6612; AAUU*AU
Sequence 2232 in group IL_90729.1 with cutoff score    52.7915 does better against group IL_82107.4 cutoff score    83.3354; AAUU*AU
Sequence 2232 in group IL_90729.1 with cutoff score    52.7915 does better against group IL_84476.1 cutoff score    79.4073; AAUU*AU
Sequence 2242 in group IL_92446.2 with cutoff score    78.7663 does better against group IL_85033.2 cutoff score    80.6348; UACC*GUGA
Sequence 2259 in group IL_95583.2 with cutoff score    93.7099 does better against group IL_15052.4 cutoff score    96.5439; CAGC*GG
Sequence 2260 in group IL_95583.2 with cutoff score    92.0214 does better against group IL_22551.4 cutoff score    94.3483; CCAG*CG
Sequence 2261 in group IL_95583.2 with cutoff score    92.0214 does better against group IL_22551.4 cutoff score    94.3483; CCAG*CG
Sequence 2262 in group IL_95583.2 with cutoff score    92.0214 does better against group IL_22551.4 cutoff score    94.3483; CCAG*CG
Sequence 2264 in group IL_95583.2 with cutoff score    78.6478 does better against group IL_00881.1 cutoff score    93.3724; GAAG*CC
Sequence 2264 in group IL_95583.2 with cutoff score    78.6478 does better against group IL_68140.4 cutoff score   100.0000; GAAG*CC
Sequence 2264 in group IL_95583.2 with cutoff score    78.6478 does better against group IL_73355.1 cutoff score    97.5087; GAAG*CC
Sequence 2264 in group IL_95583.2 with cutoff score    78.6478 does better against group IL_76709.2 cutoff score    94.2676; GAAG*CC
Sequence 2264 in group IL_95583.2 with cutoff score    78.6478 does better against group IL_81831.1 cutoff score    92.7081; GAAG*CC
Sequence 2264 in group IL_95583.2 with cutoff score    78.6478 does better against group IL_82107.4 cutoff score    94.5457; GAAG*CC
Sequence 2267 in group IL_95583.2 with cutoff score    79.2091 does better against group IL_76709.2 cutoff score    88.2398; UAAU*AG
Sequence 2267 in group IL_95583.2 with cutoff score    79.2091 does better against group IL_82107.4 cutoff score   100.0000; UAAU*AG
Sequence 2273 in group IL_96303.1 with cutoff score    93.6585 does better against group IL_30441.1 cutoff score   100.0000; GUUACGUCCGAAAG*CAC
Sequence 2280 in group IL_96332.5 with cutoff score    61.0937 does better against group IL_69145.3 cutoff score    66.1684; CCCAGG*CAAG
Sequence 2280 in group IL_96332.5 with cutoff score    61.0937 does better against group IL_75294.1 cutoff score    67.7052; CCCAGG*CAAG
